Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects

Abstract

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [Ru^II(antpy)(bpy)NO^+/˙]ⁿ⁺ [4](PF₆)₃ (n = 3), [4](PF₆)₂ (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2′′-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [Ru^II(antpy)(bpy)(Cl)](PF₆) [1](PF₆) and [Ru^II(antpy)(bpy)(CH₃CN)](PF₆)₂ [2](PF₆)₂ and [Ru^II(antpy)(bpy)(NO₂)](PF₆) [3](PF₆). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, ¹H NMR, FT-IR and UV-vis spectrophotometry. The Ru–NO stretching frequency of [4](PF₆)₃ was observed at 1941 cm⁻¹, which suggests moderately strong Ru–NO bonding. A massive shift in the ν_NO frequency occurred at Δν = 329 cm⁻¹ (solid) upon reducing [4](PF₆)₃ to [4](PF₆)₂. To understand the molecular integrity of the complexes, the structure of [3](PF₆) was successfully determined by X-ray crystallography. The redox properties of [4](PF₆)₃ were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF₆)₃ and [4](PF₆)₂ were determined to be 8.01 × 10^–3 min⁻¹ (t_1/2 ∼ 86 min) and 3.27 × 10^–2 min⁻¹ (t_1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru–NO occurred within ∼2 h when [4](PF₆)₃ was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10^–3 min⁻¹ (t_1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF₆)₃ to [4](PF₆)₂ was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF₆)₃ exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC₅₀ ∼ 8.97 μM).