Issue 31, 2020

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects

Abstract

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/˙]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2′′-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru–NO stretching frequency of [4](PF6)3 was observed at 1941 cm−1, which suggests moderately strong Ru–NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm−1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10–3 min−1 (t1/2 ∼ 86 min) and 3.27 × 10–2 min−1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru–NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10–3 min−1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 μM).

Graphical abstract: Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects

Supplementary files

Article information

Article type
Paper
Submitted
18 May 2020
Accepted
01 Jul 2020
First published
01 Jul 2020

Dalton Trans., 2020,49, 10772-10785

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects

B. Giri, T. Saini, S. Kumbhakar, K. Selvan K, A. Muley, A. Misra and S. Maji, Dalton Trans., 2020, 49, 10772 DOI: 10.1039/D0DT01788D

To request permission to reproduce material from this article, please go to the Copyright Clearance Center request page.

If you are an author contributing to an RSC publication, you do not need to request permission provided correct acknowledgement is given.

If you are the author of this article, you do not need to request permission to reproduce figures and diagrams provided correct acknowledgement is given. If you want to reproduce the whole article in a third-party publication (excluding your thesis/dissertation for which permission is not required) please go to the Copyright Clearance Center request page.

Read more about how to correctly acknowledge RSC content.

Social activity

Spotlight

Advertisements