In vitro 30 nm silver nanoparticles promote chondrogenesis of human mesenchymal stem cells

Abstract

Silver nanoparticles (Ag NPs) are one of the most widely used products in nano-medicine due to their broad-spectrum antimicrobial activity. In tissue engineering, Ag NPs are often incorporated as antibacterial agents in scaffolds, which are subsequently loaded with human bone marrow-derived mesenchymal stem cells (hMSCs). In this study, we investigated the effect of Ag NPs on chondrogenesis of hMSCs. The synthesized Ag NPs were spherical in shape, with a mean diameter of ∼30 nm. After 24 h exposure, Ag NPs were taken up into hMSCs and mainly distributed in the cytoplasm, the nucleus and different sized vesicles. We examined the chondrogenesis through several methods, including glycosaminoglycan (GAG) detection, immunohistochemical staining for type II collagen and aggrecan and real-time PCR for Sry-related high-mobility-group box 9 (SOX9), cartilage oligomeric matrix protein (COMP) and type X collagen. The present results indicate that long-term exposure to Ag NPs (at a concentration of 10 μg mL⁻¹ and 20 μg mL⁻¹) led to an increased expression of SOX9, COMP and GAG, while type II collagen expression was unaffected. Short-term exposure to Ag NPs (at a concentration of 30 μg mL⁻¹ and 40 μg mL⁻¹) resulted in a slight increase in SOX9 expression, while no change in GAG, aggrecan, type II collagen or COMP content was found. Expression of type X collagen, a marker for hypertrophic chondrocytes, was reduced after both long- and short-term exposure. In conclusion, 30 nm Ag NPs have positive effects on chondrogenesis since they can promote the expression of chondrogenic markers while reducing hypertrophy of hMSCs.

---

Introduction

In recent years nano science and nanotechnology developed into an important and rapidly growing field. Nano-silver became a commonly used nanomaterial in various applications. It displays excellent antimicrobial and antiviral properties and thus we can find a wide application of nano-silver in the medical field.^1,2 It has been used in wound dressings,³ coatings for medical tools⁴ and in bone tissue engineering.⁵ For the latter one, infection remains a common issue since implantation of engineered tissue scaffolds often requires invasive surgery.⁶ With the increasing antibiotic resistances of bacteria, silver nanoparticles (Ag NPs) gained more and more attention.⁵ A number of studies reported the application of Ag NPs in tissue engineering scaffolds, with an improved antibacterial activity and good cell compatibility.^7–9 Although nano-sized silver has been used for more than 120 years,¹⁰ there are still unaddressed concerns regarding its biocompatibility. The majority of publications show a dosage-dependent cytotoxicity, a reduced mitochondrial function, DNA damage and increased generation of reactive oxygen species (ROS) in various cell types.^11–13

When incorporating Ag NPs into bone scaffolds, their influence on the functional expression of involved cells must be known. Human bone marrow derived mesenchymal stem cells (hMSCs) are often used as seed cells in bone tissue engineering for repairing bone defects because of their high regenerative capacities. When placed in a suitable environment, they can differentiate into a number of cells,¹⁴ with adipocytes, osteocytes and chondrocytes being three of the most important cell lines for a stable bone metabolism. Among them, chondrocytes fulfil several important roles: they take part in bone healing, play an important role during enchondral ossification and can trans-differentiate to osteocytes.^15–17 Knockout studies could demonstrate the importance of chondrocytes during enchondral ossification and their possible impact on the bone mineral density and diseases as osteoarthritis.^18,19 To induce chondrogenesis of hMSCs, the pellet mass cell culture system was used, which was common for the differentiation of hMSCs into chondrocytes.^20,21 The three-dimensional cell culture system allowed cell–cell interactions and mimicked several different phases in chondrogenesis.²² It was reported that regarding to cellular distribution, gene expression, and extracellular matrix (ECM) composition, cartilage formation in pellet mass cultures was similar to native cartilage.²³

The premise to use hMSCs as seed cells and Ag NPs as antimicrobial agents simultaneously in tissue engineering scaffolds is that the negative impact of Ag NPs on the cytoactive and differentiation capacity of hMSCs should be small. Previous studies on the interaction of Ag NPs with hMSCs showed that Ag NPs exerted cytotoxic effects on hMSCs depending on the particle size, concentration and exposure time.^24–27 Till now, there are only a few reports on the influence of Ag NPs on stem cell differentiation,^6,28–31 especially chondrogenic differentiation, which may attribute to the special three-dimensional culture system. The aim of this study was to evaluate the in vitro impact of Ag NPs on chondrogenesis of hMSCs. Knowledge of the effects of Ag NPs on chondrogenesis of hMSCs is very important and necessary to determine the suitability of Ag NPs in the presence of hMSCs for tissue engineering scaffolds.

Results and discussion

Characterization of Ag NPs

TEM was used to observe the morphology of the Ag NPs, as shown in Fig. 1(A). The appearance of most Ag NPs was quasi-spherical. Fig. 1(B) shows the size distribution histogram of the nanoparticles. The particles were mainly in the size range of 27–35 nm and the average diameter was 31 ± 2 nm.

Fig. 1 (A) TEM image of Ag NPs; (B) size distribution histogram generated using image (A).

Hydrodynamic diameters of Ag NPs in different solution conditions as detected by dynamic light scattering (DLS) are shown in Table 1. In deionized water the hydrodynamic diameter of more than 90% of the nanoparticles was about 56.9 ± 1.0 nm after 1 h incubation, increasing to 75.0 ± 0.6 nm after 24 h. In MSC medium the hydrodynamic diameter of 90% of the Ag NPs was 65.3 ± 1.9 nm and almost remained constant (p > 0.05) at 62.5 ± 0.4 nm after 24 h. In chondrogenic induction medium the diameter also stayed constant, with 64.3 ± 1.6 nm after 1 h and 63.0 ± 0.8 nm after 24 h.

Table 1 DLS analysis of Ag NPs. Values are expressed as mean ± SD of triplicate experiments

DLS conditions	Hydrodynamic diameter (nm)		Zeta potential (mV)
	1 h	24 h	1 h	24 h
Deionized water	56.9 ± 1.0	75.0 ± 0.6	−10.7 ± 0.7	−18.9 ± 0.9
Growth medium	65.3 ± 1.9	62.5 ± 0.4	−8.7 ± 0.4	−11.1 ± 1.5
Chondrogenic induction medium	64.3 ± 1.6	63.0 ± 0.8	−7.5 ± 1.5	−10.4 ± 0.6

---

The zeta potential measurements conducted after 1 h and 24 h of incubation (Table 1) revealed the particle suspensions to have negative zeta values of −10.7 ± 0.7 mV, −8.7 ± 0.4 mV and −7.5 ± 1.5 mV for the deionized water, growth medium and chondrogenic induction medium after 1 h incubation, respectively. After 24 h, zeta potential increased in all the solutions, with −18.9 ± 0.9 mV, −11.1 ± 1.5 mV and −10.4 ± 0.6 mV for the deionized water, growth medium and chondrogenic induction medium, respectively.

The cell culture medium, which is rich in protein and has a high ionic content, might also have an influence on Ag NPs agglomerate or behavior. To address this, a series of DLS measurements were conducted on relevant solution conditions, with the aim of characterizing the NP size distribution and the stability of the dispersion under the experimental conditions for cellular assays. The data shows Ag NPs to have a hydrodynamic diameter larger than the particle size measured by TEM analysis. In deionized water, hydrodynamic diameter increased from 56.9 ± 1.0 nm to 75.0 ± 0.6 nm after 24 h, suggesting a slight agglomeration of the Ag NPs during incubation at 37 °C. In growth medium and chondrogenic induction medium, the hydrodynamic diameter kept almost the same during incubation at 37 °C. It may be the bovine serum albumin (BSA), a major component of FBS in the cell culture medium, that stabilizes the nanoparticles.²⁵

The absolute value of zeta potential in deionized water was higher than that in growth medium and chondrogenic induction medium, indicating that Ag NPs in deionized water were more stable than in cell culture medium. Mukherjee et al. reported that solutions with high ionic content can reduce the zeta potential of Ag NPs.³² After 24 h incubation, the increased zeta potential suggested a higher stability of Ag NPs in all solutions.

Uptake of Ag NPs into monolayer hMSCs

The uptake of Ag NPs into monolayer hMSCs was visualized by TEM as shown in Fig. 2. After exposure to Ag NPs at a concentration of 40 μg mL⁻¹ for 24 h, cells showed nanoparticle agglomerates in different areas. Fig. 2 shows that Ag NP agglomerates were distributed in the cytoplasm, the nucleus and some different sized vesicles. Most of the particles within the cells are quite densely packed, and show clear signs of aggregation. Judging from the size and structure, as shown in Fig. 2(D), we assume that the Ag NPs containing vesicles were endosomes or lysosomes.

Fig. 2 TEM images of monolayer hMSCs exposed to Ag NPs at a concentration of 40 μg mL⁻¹ for 24 h. (A) Cells showed Ag NP agglomerates in the cytoplasm (arrow I), the nucleus (arrow II) and in some different sized vesicles (arrow III). (B) Ag NPs were entrapped into vesicles inside the nucleus (arrow II) and near the cell membrane (arrow III). (C) and (D) Images show free Ag NPs in the cytoplasm (arrow I) and different sized vesicles with many Ag NPs inside (arrow III).

Many studies proved that the particle size is one of the main factors governing the cellular uptake and the distribution of NPs within the cells. Greulich et al. reported that PVP-coated Ag NPs with a diameter of 70 ± 20 nm were taken up by human peripheral monocytes but not by lymphocytes.³³ 9.15 ± 1.5 nm Ag NPs were readily internalized by human epithelial A-431 cell line and localized in intracellular vacuoles following 24 h cellular exposure.³⁴ As for stem cells, small Ag NP (with a mean diameter of 46 ± 21 nm) aggregates were found to be localized in the cell nucleus of human adipose-tissue derived MSCs and cellular compartments like vesicles or organelles as well as free in the cytoplasm,³⁵ in consistence with our results. After 7 days of incubation, Pauksch et al. could detect both, single 5–10 nm Ag NPs and clusters of nanoparticles inside the lysosomes of hMSCs.²⁵ Ag NPs of 80 nm hydrodynamic diameter entered hMSCs through clathrin-dependent endocytosis and macropinocytosis and then agglomerated inside the perinuclear region associated with the endo-lysosomal cell compartment.³⁶ However, uptake of the particles may follow different mechanisms depending on the particle size,³⁷ surface chemistry³⁸ and cell types, and thus result in varying results. Under our experimental conditions, Ag NP agglomerates were largely found in different sized endosome- or lysosome-like vesicles, suggesting endocytosis to be the possible uptake mechanism of the prepared Ag NPs into hMSCs.

Histological characterization of hMSCs pellets

In this study, for Ag NP treatment, two different methods were used. For the first method, Ag NPs, at a concentration of 10 μg mL⁻¹ or 20 μg mL⁻¹ in chondrogenic induction medium, were used to treat the pellets for up to 21 days. These two groups are named L groups in the following (L, since cells were treated with Ag NPs for a long time). This kind of treatment is more comparable to a clinical application of Ag NPs. For the second method, Ag NPs, at a concentration of 30 μg mL⁻¹ and 40 μg mL⁻¹ in growth medium, were used to treat the monolayer hMSCs for 24 h. Then, those cells were harvested and made into pellets. Pellet culture was kept in chondrogenic induction medium in the absence of Ag NPs for 21 days. These groups are called S groups (S, since cells were treated with Ag NPs for a short time). In reference to some publications focusing on the influence of other nanoparticles (quantum dots, Superparamagnetic Iron Oxide Nanoparticles) on chondrogenesis of hMSCs,^28,39 we conducted this method to investigate the effects of the already internalized Ag NPs on chondrogenesis of hMSCs.

H&E staining (Fig. 3) showed that for all the groups hMSCs formed a pelleted micromass and cells distributed homogeneously in all the pellets. As previously reported,^40,41 at the outside region, cells were flattened and arranged in parallel along the surface of the pellet, which were considered to be the undifferentiated hMSCs. In the inner domain, cells exhibited the typical round morphology of chondrocytes. Ag NPs did not affect formation and structure of the chondrogenic sphere when hMSCs were subject to chondrogenic induction.

Fig. 3 (A) H&E staining of chondrogenic pellet shows that Ag NPs did not affect formation and structure of the chondrogenic sphere. (B) Higher magnification of image (A).

Glycosaminoglycan (GAG) deposition

Glycosaminoglycan (GAG) deposition of the pellets on day 14 and 21 is shown in Fig. 4. For the L group, GAG analysis revealed that pellets cultured in the presence of Ag NPs accumulated almost the same amount of GAG on day 14 and 21 compared to the control. GAG content increased from 4.49 ± 0.36 on day 14 to 9.82 ± 0.29 on day 21 for the control group, from 4.07 ± 1.00 to 10.19 ± 0.68 for the 10 μg mL⁻¹ group and from 4.32 ± 0.58 to 9.75 ± 0.61 for the 20 μg mL⁻¹ group. Analysis of the DNA content demonstrated that on day 14 after the cells were treated with Ag NPs, the amounts of DNA per pellet were the same as that for the control (p > 0.05). There was a slight increase in the amounts of DNA on day 21 for all the groups. DNA content on day 21 for the 20 μg mL⁻¹ group (0.44 ± 0.01) was slightly lower than the control (0.48 ± 0.03). Given the differences in cell number in the pellets, GAG content was normalized to DNA content to reveal any differences in the ability of chondrogenesis among the groups. There was no significant difference for the GAG content per DNA on day 14 between the L groups and the control group. On day 21, GAG content per DNA increased for the 20 μg mL⁻¹ L group (23.45 ± 1.48) compared to control (20.60 ± 0.62).

Fig. 4 GAG and DNA content of chondrogenic pellet for different groups. (A) GAG content per pellet for L groups. (B) DNA content per pellet for L groups. (C) GAG content normalized to DNA for L groups. (D) GAG content per pellet for S groups. (E) DNA content per pellet for S groups. (F) GAG content normalized to DNA for L groups. Data are presented as mean ± SD for n = 3 samples. *, p < 0.05 compared to control.

For the S group, both the content of GAG and DNA on day 14 and 21 kept the same compared to the control group. As a result, no significant influence on GAG content per DNA on both day 14 and 21 was found for the pelleted cells which were previously treated with Ag NPs at a concentration of 30 μg mL⁻¹ and 40 μg mL⁻¹ for 24 h.

Large numbers of in vitro studies have reported that Ag NPs at cytotoxic concentrations induced impairment on a series of human cells, including keratinocytes,⁴² peripheral blood mononuclear cells,³³ A549 lung cell line⁴³ and brain astrocytes.⁴⁴ All of those cells were cultured in the monolayer culture system. Effects of Ag NPs on pelleted cells have not been addressed yet, though there may be differences to monolayer cells regarding the special three-dimensional culture microenvironment. In this study, effects of Ag NPs on pelleted cells (L groups) were investigated. The present results reveal that only for the 20 μg mL⁻¹ L group, DNA content decreased slightly compared to the control. Conversely, the content of GAG per DNA increased in the pellets that were exposed to Ag NPs throughout the differentiation (L group). In terms of this finding, Ag NPs have positive effects on chondrogenesis as they can increase the content of GAG/DNA when pelleted cells were exposed to Ag NPs at proper concentration throughout differentiation.

Expression of collagen II, aggrecan and GAG

Immunohistochemical and histological staining were carried out to analyze the expression of type II collagen, aggrecan and GAG in sections of the pellets. Results show that type II collagen was homogenously synthesized in all the groups and there seems to be no significant difference in the expression of type II collagen between the experimental groups and the control group. Positive staining for aggrecan was observed for all the groups. The staining for the 20 μg mL⁻¹ L group showed stronger intensity in the peripheral region (arrows in Fig. 5) compared to the other groups, which displayed homogenous distribution of brown color, suggesting a higher expression of aggrecan.

Fig. 5 Immunohistochemical staining for type II collagen and aggrecan and Alcian blue staining for GAG. Arrows show that the staining for the 20 μg mL⁻¹ L group was of stronger intensity in the peripheral region compared to the other groups, implying a higher expression of aggrecan.

Alcian blue staining displayed a varying degree of GAG accumulation in the microspheres for different groups. Consistent with the DMMB assay, GAG content increased for the L groups compared to the control. For the S groups, GAG content was the same as in the control.

In this study, in order to better visualize the antigen expression, the sections were not counterstained with hematoxylin or any other dyes. The presence of another chromogen may interfere with the judgment of actual antigen level, as proved by a number of groups.^45,46 The present results show an unaffected expression of type II collagen, an improved deposition of aggrecan and GAG after long-term exposure to Ag NPs (21 days), while short-term exposure to Ag NPs (24 h) did not influence the expression of type II collagen, aggrecan and GAG.

Quantitative real-time polymerase chain reaction (real-time PCR)

Chondrogenic differentiation was analyzed by quantitative real-time polymerase chain reaction (real-time PCR) for mRNA of Sry-related high-mobility-group box 9 (SOX9), cartilage oligomeric matrix protein (COMP) and type X collagen. As shown in Fig. 6, with the expression of all genes set to 1 for the control group, both the SOX9 and COMP mRNA expression (4.97 ± 0.16 and 2.15 ± 0.25, respectively) for the 20 μg mL⁻¹ L group were significantly higher than those for the control group. In contrast, type X collagen expression showed significantly lower values (0.08 ± 0.01) compared to the control. For the S group, the expression of SOX9 (1.33 ± 0.14) was slightly higher than that in the control group and there was no significant difference in the expression of COMP (1.12 ± 0.11). The expression of type X collagen (0.12 ± 0.03) was also significantly inhibited in comparison with the control.

Fig. 6 mRNA expression of SOX9, COMP and type X collagen. HMSCs were cultured in a pellet format for 14 days and then were harvested. RNA was extracted for real time PCR. Data are presented as mean ± SD for n = 3 samples. *, p < 0.05 compared to control; **, p < 0.01 compared to control.

The chondrogenesis of hMSCs involves rapid biosynthesis of glycosaminoglycan and deposition of an integrated ECM, which contains aggrecan, decorin, biglycan, fibromodulin and type II collagen as well as several other key matrix components, including COMP,⁴⁷ a pentameric glycoprotein which is a member of the thrombospondin family.

The transcription factor SOX9 is a master regulator of chondrogenesis and mandatory at sequential steps along the pathway.^48,49 SOX9 is indispensable for glycosaminoglycan synthesis and the chondrocyte-specific matrix proteins expression, including type II collagen and aggrecan.^50,51 Furthermore, SOX9 inhibits transition of proliferating chondrocytes to hypertrophic chondrocytes.⁴⁸ Up-regulation of COMP supports chondrocyte attachment though interaction with integrins.⁵² It also protects chondrocytes against cell death.⁵³ Aggrecan and type II collagen are commonly used markers for chondrogenesis and the formation of cartilage.⁵⁴ Aggrecan is a extracellular proteoglycan interacting with hyaluronan, forming large aggregates.⁵⁵ These aggregates are mandatory for the ability of tissues to resist compressive loads.⁵⁶ Type II and type X collagen are both important extracellular matrix proteins. Since type II collagen is expressed in all chondroprogenitor cells and in chondrocytes at high levels,⁵⁷ it is an ideal marker for chondrogenesis. In contrast to type II, type X collagen is associated with later stages of chondrogenic differentiation and facilitates enchondral ossification. Mainly, it can be found in hypertrophic chondrocytes.⁵⁸

There are several other reports on the influence of different nanoparticles on chondrogenesis of hMSCs. Kostura et al. found that hMSCs exposed to Feridex fail to generate type II collagen and safranin-O-positive extracellular matrix within 21 days of micromass culture.⁵⁹ Chang et al. proved that expression of GAG, aggrecan and type II collagen were not detectable after hMSCs were labeled with amine-surface-modified Superparamagnetic Iron Oxide Nanoparticles.³⁹ Hsieh et al. indicated that the Internalized CdSe/ZnS Quantum Dots impair the chondrogenesis of hMSCs through inhibiting the expression of mRNA and protein of type II collagen and aggrecan.⁶⁰ These findings prove that some of the nanoparticles do negatively influence the chondrogenic differentiation of hMSCs. However, for Ag NPs, the situation was found to be different. In this study, we found that long-term exposure to Ag NPs caused an increase in GAG deposition, as well as SOX9, COMP and aggrecan expression, while expression of type II collagen was not altered. Short-term exposure to Ag NPs resulted in slight increase in SOX9 expression while no changes of GAG, aggrecan, type II collagen or COMP content. Expression of type X collagen, a marker for hypertrophic chondrocytes, was reduced both in the L and S group (Scheme 1). Lower expression of type X collagen goes in accordance with higher SOX9 expression, which inhibits the transition from proliferating chondrocytes to hypertrophic chondrocytes. Thus, we conclude that Ag NPs have positive effects on chondrogenesis and cause inhibition of the transition into hypertrophic chondrocytes, especially when the cells are exposed throughout the differentiation.

Scheme 1 Schematic illustration of the effect of Ag NPs on chondrogenesis of hMSCs.

While the cytotoxicity and genotoxicity of Ag NPs is well studied, little is known on their impact on stem cell differentiation, especially chondrogenic differentiation.^6,28–31 Our previous reports focusing on the adipogenic and osteogenic differentiation of hMSCs did show an unaffected differentiation capacity of hMSCs after 30 nm Ag NPs treatment.^29,61 Similar results were also obtained by Samberg et al., proving that exposure to 10 or 20 nm Ag NPs did not influence the adipogenic and osteogenic differentiation of human adipose-derived stem cells (hASCs).⁶ Pauksch et al. found no influence on the activity of alkaline phosphatase in hMSCs in the presence of 5–10 nm Ag NPs at subtoxic levels even after prolonged cell culture (35 days).²⁵ However, some other groups observed different results. Qin et al. indicated that 20 nm Ag NPs can promote osteogenic differentiation of urine-derived stem cells (USCs) at a suitable concentration via activating RhoA and increasing cytoskeletal tension in USCs.³⁰ In contrast, Sengstock et al. showed that the adipogenic and osteogenic differentiation of hMSCs was impaired at subtoxic concentrations of 50 nm Ag NPs.³¹ As for the chondrogenic differentiation, only one publication investigated the short-term (24 h) influence of 50 nm Ag NPs on chondrogenesis of hMSCs,³¹ using only two tests, Alcian blue staining for GAG and quantitative aggrecan detection. The authors found no influence on the expression of these two markers, in accordance with the results in this research. In summary, the effect of Ag NPs on stem cell differentiation strongly depends on the respective type and concentration of the particles, the exposure time and the cell types.

In this work, we only studied one type of Ag NPs. However, the biological characteristics of Ag NPs vary widely according to particle size,³⁷ shape,⁶² and surface chemistry.⁶³ More research has to be done in the future to assess the effects of different types of Ag NPs on chondrogenesis of hMSCs before hMSCs and Ag NPs can be used simultaneously in tissue-engineered scaffolds. Furthermore, the mechanism involved in the effect of Ag NPs on the chondrogensis of hMSCs remains to be investigated in detail.

Experimental

Materials

Silver nitrate (AgNO₃) was purchased from Beijing chemical works (China). Polyvinyl pyrrolidone (PVP K 30) was obtained from Beijing NuoQiYa Biotech Co., Ltd (China). Ethylene glycol (EG), acetone and ethanol were form Beijing modern oriental fine chemistry Co., Ltd (China). Other chemicals and reagents were obtained from Sigma-Aldrich (USA) if not illustrated specifically.

Preparation and characterization of Ag NPs

Ag NPs were prepared as previously reported by Li et al.⁶⁴ In brief, 0.5 g PVP in 15 mL of EG was magnetically stirred and heated to ∼160 °C in an oil bath within 30 min. The temperature was then lowered to 120 °C during the subsequent 30 min. Then, 5 mL EG containing 0.1 g AgNO₃ was added dropwise into the above solution within 2 min. The reaction continued for another 3 min under continuous stirring at 120 °C. Ag NP colloid dispersion was cooled down in air and then excess acetone was added to the solution. The mixture was centrifuged and repeatedly washed to obtain purified Ag NPs. The final sample was air-dried.

The size and morphology of the nanoparticles were visualized by TEM (TEM, H-7650B, Hitachi, Japan). The size and size distribution of the nanoparticles was measured using the program Nano measurer 1.2.5 while measuring at least 100 nanoparticles to get representative data. The hydrodynamic diameter and the zeta potential of the Ag NPs in different cell media were measured by DLS using a Malvern Zetasizer Nano Measurements (ZS90, UK). To determine the hydrodynamic diameter and the zeta potential of the Ag NPs at different time points, they were diluted in the deionized water, growth medium and chondrogenic induction medium to a concentration of 40 μg mL⁻¹. Samples were kept at 37 °C between measurements.

Cell culture and suspension of Ag NPs

HMSCs, purchased from Cyagen Biosciences Inc (Guangzhou, China), were cultured in a defined growth medium (Cyagen Biosciences Inc, China) consisting of 88% hMSC basal medium, 10% fetal bovine serum (FBS), 1% glutamine and 1% penicillin–streptomycin. To induce chondrogenic differentiation, cells were cultured in chondrogenic induction medium (StemPro Chondrogenesis Differentiation Kit, Gibco, USA). The medium was changed every 3 days. All cultures were kept in a humidified incubator containing 95% air and 5% CO₂ at 37 °C. Cells at passage 6 were used in the experiments. Ag NP suspensions were prepared as described in detail previously.²⁹

Pellet culture and Ag NP treatment

Pellet culture was performed to induce chondrogenic differentiation. For Ag NP treatment, two different methods were used. For the L group, hMSCs were firstly seeded at 30–40% confluency in growth medium in a 10 mm culture dish. When the cells reached approximately 80 to 90% confluency, they were washed twice with phosphate buffered saline (PBS, 0.01 M, Corning, USA) and then harvested with 0.25% trypsin–EDTA (Gibco, USA). Afterwards, approximately 2.5 × 10⁵ cells were placed in a 15 mL polypropylene tube (Corning, USA), centrifuged at 500 g for 4 min at room temperature and resuspended in chondrogenic induction medium. The cells were centrifuged again to achieve aggregation. Then, Ag NP suspension at a concentration of 1 mg mL⁻¹ was carefully added to the medium to achieve a concentration of 10 μg mL⁻¹ and 20 μg mL⁻¹. The cells were maintained in culture for up to 21 days in the presence of Ag NPs. For the S group, cells were seeded at the same density as for the first method. When the cells reached approximately 70 to 80% confluency, Ag NPs, at a concentration of 30 μg mL⁻¹ and 40 μg mL⁻¹ in growth medium, were used to treat the cells for 24 h. Then, cells were washed twice with PBS and harvested with 0.25% trypsin–EDTA (Gibco, USA). Pellet culture was performed as described earlier and cells were maintained in chondrogenic induction medium in the absence of Ag NPs for 21 days.

TEM observation for the uptake of Ag NPs in monolayer hMSCs

TEM was used to observe the uptake of Ag NPs into hMSCs. In brief, hMSCs were harvested with trypsin after exposure to 40 μg mL⁻¹ Ag NPs in growth medium for 24 h. After harvesting, the cells were washed with PBS (Corning, USA) and fixed by immersion in 2.5% glutaraldehyde at 4 °C for 24 h. The post-fixation was performed with 1% osmium tetroxide in 0.1 M cacodylate buffer at 4 °C for 1 h. Cells were then dehydrated in a graded series of ethanol (40 to 100%) and embedded in resin. Ultrathin sections (70 nm) were cut with a Lecia Ultracut E microtome (Lecia EM UC6, Lecia, Germany) and collected on copper grids. They were not stained for a better visualization of the Ag NPs.

Histology and immunohistology

After 21 days of culture, pellets were harvested and fixed with 10% PBS-buffered paraformaldehyde overnight at 4 °C. Afterwards, they were dehydrated by treatment with a series of graded alcohol, cleared by treatment with xylene and xylene substitutes and embedded in paraffin. After that, pellets were cut into 5 μm thick sections with a rotary microtome (LEICA RM2235). For histological analyses, sections were first deparaffinized in xylene and rehydrated in decreasing ethanol concentrations. Then, they were stained with hematoxylin and eosin (H&E) or Alcian blue to visualize the GAG deposition. For immunohistology, type II collagen and aggrecan were detected using rabbit polyclonal antibody ab19819 (Abcam, Cambridge, UK) and rabbit monoclonal antibody [ERP14664] ab186414, (Abcam, Cambridge, UK), respectively. After deparaffinization, sections were treated with 0.3% H₂O₂ in methanol to block endogenous peroxidase activity. Heated mediated antigen retrieval was then performed with citrate buffer for optimal antigen retrieval. To prevent nonspecific background staining, sections were treated with 10% normal goat serum for 1 h at room temperature. Then, sections were incubated with primary antibodies at 4 °C overnight, followed by incubation for 30 min at room temperature with goat anti-rabbit secondary antibody (Dako, Glostrup, Denmark) conjugated to peroxidase. Peroxidase activity was visualized using TMB.

GAG quantification

Chondrogenic pellets were harvested at day 14 and 21 for quantitative analysis of GAG. The pellets were digested with papain buffer (25 μg mL⁻¹ in 50 mM sodium dihydrogen phosphate, pH 6.5, containing 2 mM L-cysteine and 2 mM EDTA) at 65 °C for 8 h, as reported previously.⁶⁵ GAG content of the pellets was measured by the 1,9-dimethylmethylene blue (DMMB) assay.⁶⁶ The amount of GAG was calculated by using shark chondroitin sulfate as standard. Results of GAG quantification were normalized to the DNA content. The DNA content was determined with Hoechst 33258, using calf thymus DNA as standard.⁶⁵ Both of the assays were carried out in triplicate for each group. Data are represented as mean ± standard deviation (SD).

Real-time PCR

On day 14 after induction, chondrogenic pellets were harvested for analysis of gene expression. Total RNA from hMSCs of the 20 μg mL⁻¹ L group and 40 μg mL⁻¹ S group was extracted using Trizol Plus RNA purification kit (Invitrogen, USA). 1 μg of the extracted RNA was reverse transcribed into cDNA using a QIAGEN RNeasy Mini Kit (Qiagen, Germany). Real time PCR was performed on a real time PCR system (BioRad CFX96, USA) using a SYBR Green I (TAKARA). The expressions of SOX9, COMP and type X collagen were tested and β-actin served as a housekeeping gene. Normalized values were compared to the control group. Primers used for real-time PCR are listed in Table 2.

Table 2 Primer sequences used for real-time PCR

Gene	Primer (5′ → 3′)	PCR product size
SOX9	F: AGCGCCCCCACTTTTGCTCTTT	118 bp
	R: CCGCGGCGAGCACTTAGGAAG
COMP	F: GAACGCTCTGTGGCATACA	106 bp
	R: CAGGAACCAACGATAGGACTTC
Type X collagen	F: ACCCAAGGACTGGAATCTTTAC	107 bp
	R: GCCATTCTTATACAGGCCTACC
β-actin	F: ACTTAGTTGCGTTACACCCTT	156 bp
	R: GTCACCTTCACCGTTCCA

---

Statistical analysis

Statistical analysis of the obtained data was performed using SPSS software, version 15.0.1. The values were represented as the mean ± standard deviation (SD) of three independent experiments. The data was analyzed by the least significant difference (LSD) method and p < 0.05 was considered to be statistically significant.

Conclusions

In tissue engineering, Ag NPs are used as antimicrobial agents and hMSCs are ideal seed cells. While effects of Ag NPs on cytotoxicity, adipogenesis and osteogenesis of hMSCs have been addressed, there is a distinct lack of information on the influence of Ag NPs on chondrogenesis of hMSCs. This study was conducted to evaluate the effects of Ag NPs upon the chondrogenic differentiation of hMSCs. Results showed that Ag NPs have positive effects on chondrogenesis since they can promote the expression of chondrogenic markers while reduce hypertrophy of hMSCs. One of the most important investigations in both tissue regeneration and stem cells research is to control the fate of the stem cells towards specific lineages. Our results suggest that the incorporation of Ag NPs as an antimicrobial filler in scaffolds might have positive impact on the stem cell lineage commitment. Ag NPs released from such nanocomposites might regulate the commitment of stem cells to chondrocyte lineage.

Acknowledgements

The authors are grateful for the financial support from National Natural Science Foundation of China (51361130032, 51472139) and Doctor Subject Foundation of the Ministry of Education of China (20120002130002).

Notes and references

1. J. R. Morones, J. L. Elechiguerra, A. Camacho, K. Holt, J. B. Kouri, J. T. Ramirez and M. J. Yacaman, Nanotechnology, 2005, 16, 2346–2353.
2. J. S. Kim, E. Kuk, K. N. Yu, J. H. Kim, S. J. Park, H. J. Lee, S. H. Kim, Y. K. Park, Y. H. Park, C. Y. Hwang, Y. K. Kim, Y. S. Lee, D. H. Jeong and M. H. Cho, Nanomedicine, 2007, 3, 95–101.
3. D. N. Heo, D. H. Yang, J. B. Lee, M. S. Bae, J. H. Kim, S. H. Moon, H. J. Chun, C. H. Kim, H. N. Lim and I. K. Kwon, J. Biomed. Nanotechnol., 2013, 9, 511–515.
4. D. Roe, B. Karandikar, N. Bonn-Savage, B. Gibbins and J. B. Roullet, J. Antimicrob. Chemother., 2008, 61, 869–876.
5. S. Saravanan, S. Nethala, S. Pattnaik, A. Tripathi, A. Moorthi and N. Selvamurugan, Int. J. Biol. Macromol., 2011, 49, 188–193.
6. M. E. Samberg, E. G. Loboa, S. J. Oldenburg and N. A. Monteiro-Riviere, Nanomedicine, 2012, 7, 1197–1209.
7. Z. Zheng, W. Yin, J. N. Zara, W. Li, J. Kwak, R. Mamidi, M. Lee, R. K. Siu, R. Ngo, J. Wang, D. Carpenter, X. Zhang, B. Wu, K. Ting and C. Soo, Biomaterials, 2010, 31, 9293–9300.
8. Y. Liu, Z. Zheng, J. N. Zara, C. Hsu, D. E. Soofer, K. S. Lee, R. K. Siu, L. S. Miller, X. Zhang, D. Carpenter, C. Wang, K. Ting and C. Soo, Biomaterials, 2012, 33, 8745–8756.
9. H.-W. Chang, Y.-S. Lin, Y.-D. Tsai and M.-L. Tsai, J. Appl. Polym. Sci., 2013, 127, 169–176.
10. B. Nowack, H. F. Krug and M. Height, Environ. Sci. Technol., 2011, 45, 1177–1183.
11. A. Hekmat, A. A. Saboury and A. Divsalar, J. Biomed. Nanotechnol., 2012, 8, 968–982.
12. C. Carlson, S. M. Hussain, A. M. Schrand, L. K. Braydich-Stolle, K. L. Hess, R. L. Jones and J. J. Schlager, J. Phys. Chem. B, 2008, 112, 13608–13619.
13. L. Braydich-Stolle, S. Hussain, J. J. Schlager and M. C. Hofmann, Toxicol. Sci., 2005, 88, 412–419.
14. M. F. Pittenger, A. M. Mackay, S. C. Beck, R. K. Jaiswal, R. Douglas, J. D. Mosca, M. A. Moorman, D. W. Simonetti, S. Craig and D. R. Marshak, Science, 1999, 284, 143–147.
15. C. T. Brighton and R. M. Hunt, J. Bone Jt. Surg., Am. Vol., 1986, 68, 703–715.
16. L. C. Gerstenfeld and F. D. Shapiro, J. Cell. Biochem., 1996, 62, 1–9.
17. L. Yang, K. Y. Tsang, H. C. Tang, D. Chan and K. S. Cheah, Proc. Natl. Acad. Sci. U. S. A., 2014, 111, 12097–12102.
18. M. Wu, Y. P. Li, G. Zhu, Y. Lu, Y. Wang, J. Jules, M. McConnell, R. Serra, J. Z. Shao and W. Chen, Int. J. Biol. Sci., 2014, 10, 861–872.
19. L. van der Weyden, L. Wei, J. Luo, X. Yang, D. E. Birk, D. J. Adams, A. Bradley and Q. Chen, Am. J. Pathol., 2006, 169, 515–527.
20. T. Svanvik, H. B. Henriksson, C. Karlsson, M. Hagman, A. Lindahl and H. Brisby, Cells Tissues Organs, 2010, 191, 2–11.
21. C. Karlsson, C. Brantsing, T. Svensson, H. Brisby, J. Asp, T. Tallheden and A. Lindahl, J. Orthop. Res., 2007, 25, 152–163.
22. B. Johnstone, T. M. Hering, A. I. Caplan, V. M. Goldberg and J. U. Yoo, Exp. Cell Res., 1998, 238, 265–272.
23. T. Tallheden, C. Karlsson, A. Brunner, J. Van Der Lee, R. Hagg, R. Tommasini and A. Lindahl, Osteoarthritis Cartilage, 2004, 12, 525–535.
24. W. He, X. Liu, A. Kienzle, W. E. G. Müller and Q. Feng, J. Nanosci. Nanotechnol., 2015 DOI:10.1166/jnn.2015.10728.
25. L. Pauksch, S. Hartmann, M. Rohnke, G. Szalay, V. Alt, R. Schnettler and K. S. Lips, Acta Biomater., 2014, 10, 439–449.
26. C. Greulich, S. Kittler, M. Epple, G. Muhr and M. Koller, Langenbecks Arch. Surg., 2009, 394, 495–502.
27. S. Kittler, C. Greulich, M. Köller and M. Epple, Materialwiss. Werkstofftech., 2009, 40, 258–264.
28. J. C. Chang, S. H. Hsu and H. L. Su, Biomaterials, 2009, 30, 1937–1946.
29. X. Liu, W. He, Z. Fang, A. Kienzle and Q. Feng, J. Biomed. Nanotechnol., 2014, 10, 1277–1285.
30. H. Qin, C. Zhu, Z. An, Y. Jiang, Y. Zhao, J. Wang, X. Liu, B. Hui, X. Zhang and Y. Wang, Int. J. Nanomed., 2014, 9, 2469–2478.
31. C. Sengstock, J. Diendorf, M. Epple, T. A. Schildhauer and M. Koller, Beilstein J. Nanotechnol., 2014, 5, 2058–2069.
32. B. Mukherjee and J. W. Weaver, Environ. Sci. Technol., 2010, 44, 3332–3338.
33. C. Greulich, J. Diendorf, J. Gessmann, T. Simon, T. Habijan, G. Eggeler, T. A. Schildhauer, M. Epple and M. Koller, Acta Biomater., 2011, 7, 3505–3514.
34. K. K. Comfort, E. I. Maurer, L. K. Braydich-Stolle and S. M. Hussain, ACS Nano, 2011, 5, 10000–10008.
35. S. Hackenberg, A. Scherzed, M. Kessler, S. Hummel, A. Technau, K. Froelich, C. Ginzkey, C. Koehler, R. Hagen and N. Kleinsasser, Toxicol. Lett., 2011, 201, 27–33.
36. C. Greulich, J. Diendorf, T. Simon, G. Eggeler, M. Epple and M. Koller, Acta Biomater., 2011, 7, 347–354.
37. J. Rejman, V. Oberle, I. S. Zuhorn and D. Hoekstra, Biochem. J., 2004, 377, 159–169.
38. P. Nativo, I. A. Prior and M. Brust, ACS Nano, 2008, 2, 1639–1644.
39. Y. K. Chang, Y. P. Liu, J. H. Ho, S. C. Hsu and O. K. Lee, J. Orthop. Res., 2012, 30, 1499–1506.
40. L. A. Solchaga, K. Penick, J. D. Porter, V. M. Goldberg, A. I. Caplan and J. F. Welter, J. Cell. Physiol., 2005, 203, 398–409.
41. L. A. Solchaga, K. Penick, V. M. Goldberg, A. I. Caplan and J. F. Welter, Tissue Eng., Part A, 2010, 16, 1009–1019.
42. M. E. Samberg, S. J. Oldenburg and N. A. Monteiro-Riviere, Environ. Health Perspect., 2010, 118, 407–413.
43. R. M. Gengan, K. Anand, A. Phulukdaree and A. Chuturgoon, Colloids Surf., B, 2013, 105, 87–91.
44. E. M. Luther, Y. Koehler, J. Diendorf, M. Epple and R. Dringen, Nanotechnology, 2011, 22, 375101.
45. E. M. Brey, Z. Lalani, C. Johnston, M. Wong, L. V. McIntire, P. J. Duke and C. W. Patrick Jr, J. Histochem. Cytochem., 2003, 51, 575–584.
46. N. A. Pham, A. Morrison, J. Schwock, S. Aviel-Ronen, V. Iakovlev, M. S. Tsao, J. Ho and D. W. Hedley, Diagn. Pathol., 2007, 2, 8.
47. A. Oldberg, P. Antonsson, K. Lindblom and D. Heinegard, J. Biol. Chem., 1992, 267, 22346–22350.
48. H. Akiyama, M. C. Chaboissier, J. F. Martin, A. Schedl and B. de Crombrugghe, Genes Dev., 2002, 16, 2813–2828.
49. W. Bi, J. M. Deng, Z. Zhang, R. R. Behringer and B. de Crombrugghe, Nat. Genet., 1999, 22, 85–89.
50. S. R. Tew, Y. Li, P. Pothacharoen, L. M. Tweats, R. E. Hawkins and T. E. Hardingham, Osteoarthritis Cartilage, 2005, 13, 80–89.
51. M. Cucchiarini, T. Thurn, A. Weimer, D. Kohn, E. F. Terwilliger and H. Madry, Arthritis Rheum., 2007, 56, 158–167.
52. F. H. Chen, A. O. Thomas, J. T. Hecht, M. B. Goldring and J. Lawler, J. Biol. Chem., 2005, 280, 32655–32661.
53. J. T. Hecht, O. Makitie, E. Hayes, R. Haynes, M. Susic, D. Montufar-Solis, P. J. Duke and W. G. Cole, J. Orthop. Res., 2004, 22, 759–767.
54. D. Bosnakovski, M. Mizuno, G. Kim, T. Ishiguro, M. Okumura, T. Iwanaga, T. Kadosawa and T. Fujinaga, Exp. Hematol., 2004, 32, 502–509.
55. H. Watanabe, Y. Yamada and K. Kimata, J. Biochem., 1998, 124, 687–693.
56. P. Roughley, D. Martens, J. Rantakokko, M. Alini, F. Mwale and J. Antoniou, Eur. Cells Mater., 2006, 11, 1–7 , discussion 7.
57. K. S. Cheah, E. T. Lau, P. K. Au and P. P. Tam, Development, 1991, 111, 945–953.
58. G. Shen, Orthod. Craniofac. Res., 2005, 8, 11–17.
59. L. Kostura, D. L. Kraitchman, A. M. Mackay, M. F. Pittenger and J. W. Bulte, NMR Biomed., 2004, 17, 513–517.
60. S. C. Hsieh, F. F. Wang, S. C. Hung, Y. J. Chen and Y. J. Wang, J. Biomed. Mater. Res., Part B, 2006, 79, 95–101.
61. W. He, A. Kienzle, X. Liu, W. E. G. Müller, T. A. Elkhooly and Q. Feng, RSC Adv., 2015 10.1039/c5ra06386h.
62. S. Pal, Y. K. Tak and J. M. Song, Appl. Environ. Microbiol., 2007, 73, 1712–1720.
63. I. Sur, D. Cam, M. Kahraman, A. Baysal and M. Culha, Nanotechnology, 2010, 21, 175104.
64. L. Li, J. Sun, X. Li, Y. Zhang, Z. Wang, C. Wang, J. Dai and Q. Wang, Biomaterials, 2012, 33, 1714–1721.
65. L. A. Solchaga, K. J. Penick and J. F. Welter, Methods Mol. Biol., 2011, 698, 253–278.
66. R. W. Farndale, D. J. Buttle and A. J. Barrett, Biochim. Biophys. Acta, 1986, 883, 173–177.

---

Footnotes

† This contribution contains parts of the dissertation of Arne Kienzle.

‡ These authors contributed equally to this work.

---