Gold nanoparticles as potent anticancer agent: green synthesis, characterization, and in vitro study

Abstract

Biogenic high quality colloidal gold nanoparticles (AuNPs), as one of the best anticancer theranostic nanostructures among those reported to date, were synthesized via a simple, efficient and green chemical method using aqueous and ethanolic Taxus baccata extracts and comprehensively characterized by UV-vis spectroscopy, TEM, SEM, AFM, DLS, Zetasizer, EDS, and FT-IR techniques. The AuNPs, encapsulated by the ethanolic compounds of T. baccata with different shapes and uniform size of less than 20 nm and polydispersity index of 0.276, were found completely stable for several months. In consistent with the results of microscopic observations of cell morphology, MTT assay revealed a potent, selective, dose- and time-dependent anticancer activity of AuNPs on the prevalent cancer cell lines including breast (MCF-7), cervical (HeLa) and ovarian (Caov-4), more effective than most of the other reported similar cases. The detailed in vitro investigation of cell exposure by AuNPs, using flow cytometry and real-time PCR, indicated caspase-independent death program as most probable anticancer mechanism of AuNPs. The overall results firmly indicated that the organic compounds of T. baccata, as appropriate reducing and stabilizing agents, not only significantly affect the physicochemical properties of AuNPs but also led to the green synthesis of potent anticancer agent with high potential for cancer therapy.

---

Introduction

Noble metal nanoparticles have found great promise for industrial as well as biomedical applications especially in catalysis, electronics, optics, sensing, imaging and therapy.^1,2 Their attractive physicochemical properties raised from quantum confinement effects and large reactive surfaces together with interesting biological activities have been greatly considered in recent years.^3–5 The non-toxic and non-immunogenic nature of gold nanoparticles (AuNPs), possibility to synthesize AuNPs with controlled size and shape, and easy conjugation with targeting biomolecules and drugs, have highlighted these nanoparticles for biotechnological and biomedical applications.^6,7 In this regards, targeted drug delivery,^8,9 cellular imaging,^10,11 diagnosing^12,13 and bio-sensing,^14–16 have been the active fields of research. As the physicochemical properties of AuNPs are drastically affected by their size, shape and crystal structure, development of facile and efficient methods for synthesis of high quality monodisperse AuNPs with appropriate morphology, is essential.¹ The surface properties, mainly defined by stabilizing agents and functional groups, are another important parameters that significantly determine the biological activity and fate of nanoparticles.¹⁷

The classical approach of chemical synthesis has raised the concerns for environmental contaminations and human health due to the large amount of hazardous byproducts¹⁸ and potent cytotoxicity of produced nanomaterials, respectively.¹⁹ Thus, development of the efficient and environmentally benign methods is necessary for the production of greener nanomaterials with high reproducibility and purity.²⁰ The green chemistry methods, exploiting organisms or their extracted compounds instead of chemical substances as reducing or stabilizing agents, have recently drawn remarkable interest for production of metal nanoparticles.²¹ The high potential of biogenic methods for large scale production of nanoparticles with reduced environmental issues as well as emerging novel and valuable properties, led to the increasing attention to this approach.²²

Plant based biogenic method is one of the best candidates for large-scale production of nanoparticles with well-defined size and morphology.²³ A variety of plant organic compounds including alkaloids, phenolics, terpenoids and coenzymes have been reported as potent reducing and capping agents for green synthesis of metal nanoparticles.²² The combination of inherent physicochemical properties of nanoparticles with those of biomolecules could led to the development of functionalized nano-biological constructs with attracting characteristics.²⁴ A variety of biogenic AuNPs, with different therapeutic properties such as vermifugal,²⁵ antibacterial,²⁶ antifungal²⁷ and anticancer,^28,29 have been recently reported. Regarding to the poor bioavailability and selectivity and serious toxicity of gold-based anticancer complexes,³⁰ the biogenic AuNPs without these deficiencies, would display a promising chemotherapeutic potential for cancer therapy.

The high content of diterpenoid taxanes in Taxus tissues is a potent agent for the synthesis and stabilizing of metal nanoparticles and can also deliver new biological features especially anticancer activity to the nanoparticles. The organic compounds of Taxus extracts were successfully used in our recent study for the synthesis of silver nanoparticles.²⁰ These nanoparticles displayed potent anticancer activity resulted from synergistic effects of silver nanostructures and the adsorbed organic compounds.

In continuation of our research in this area, the stable and monodisperse colloidal AuNPs were biologically synthesized in the presence of Taxus baccata extract and characterized using different methods. After that, a comprehensive study was conducted to investigate the anticancer activity of AuNPs on different cancer cell lines, in vitro, by different cellular and molecular methods.

Results and discussion

Synthesis and characterization of AuNPs

The potential of Taxus extracts to reduce chloroauric acid and synthesis of high quality AuNPs, was comprehensively studied via optimization of the main affecting factors on the synthesis reaction, including the type and concentration of plant extract (as reducing and capping agents) as well as the concentration of metal substrate. The extraction solvents were rationally selected to efficiently concentrate the hydrophobic taxane compounds in the ethanolic extract while the hydrophilic compounds were selectively extracted in the aqueous fraction. The fractionation of organic compounds could reduce the complexity of reactions and facilitate the interpretation of the results. As the polyols such as terpenoids, flavonoids and polysaccharides have been the particular focus of plant based syntheses of metal nanoparticles,²² taxane diterpenoids, abundantly found in Taxus tissues, seem to be suitable candidates for this purpose. Since terpenoids contain different functional groups including amines, alcohols, ketones, aldehydes, and carboxylic acids, these organic compounds could be considered as surface active molecules for the synthesis of metal nanoparticles.³¹ The biomolecules act as template via specific interactions with inorganic materials toward the controlled synthesis of nanoparticles.¹ The final morphology of nanostructures is highly dependent on their physicochemical interactions with biomolecules. Therefore, the chemical nature of taxanes as well as their composition efficiently have an effect on bio-mineralization processes and could potentially act as template for the development of novel nanostructures. Moreover, the famous antitumor properties of taxanes provoke further studies toward the development of novel approach of cancer therapy.

HPLC analysis confirmed the high efficiency of ethanol for the extraction of taxane compounds (Fig. S1†) as the average extraction yields of 0.073, 0.066, and 0.081 mg g⁻¹ were obtained for Taxol, 10-deacetyl baccatin III, and baccatin III, respectively, comparable with the previous report.³² In fact, 80% ethanol solution was rationally selected as efficient extraction solvent of taxanes to specifically and efficiently isolate the taxane compounds in order to better clarify their capability for the synthesis of gold nanoparticles. The main diterpenoid taxanes of Taxus ethanolic extract including Taxol, baccatin III, 10-deacetyl baccatin III, cephalomannine, 10-deacetyl paclitaxel, 7-xyl-10-deacetyl paclitaxel, and 7-epi-10-deacetyl paclitaxel have been previously determined.^32,33 Regarding to the high potential of the terpenoids for synthesis of nobel metal nanoparticles by reducing the metal salts, these taxanes could be considered as main agents of gold nanoparticles synthesis.

A set of colloids with diverse colors (e.g. orange, pink, red, purple, and violet) were obtained by using different types of Taxus extract (prepared by different solvents) as well as various concentrations of each extract. The observed color range is resulted from surface plasmon resonance (SPR) of the colloidal AuNPs with different shapes and sizes.³⁴ This color diversity could be attributed to the variability of chemical nature and concentration of organic compounds for each reaction which can also directly affect the synthesis, growth, quantity and quality of the produced nanoparticles. The results showed that the increasing of Taxus extract concentration mainly led to the higher absorption intensity, indicating improved yield of the reaction. Monitoring the reactions by UV-vis spectroscopy revealed that most of the colloidal nanoparticles display two high intensity, well-separated, absorption bands located around 300–400 nm and 500–600 nm (Fig. 1). The intensity of plasmon bands changed based on the reaction composition (Fig. 1).

Fig. 1 UV-vis spectra of AuNPs synthesized in the presence of 1 mL extract and 0.1 mM HAuCl₄ (a), 1 mL extract and 0.2 mM HAuCl₄ (b), 2 mL extract and 0.1 mM HAuCl₄ (c), and 2 mL extract and 0.2 mM HAuCl₄ (d). The figure inset shows corresponding color of colloidal nanoparticles.

It is well-known that the anisotropic AuNPs exhibit two prominent absorption bands including a low wavelength transverse absorption band and a longer wavelength longitudinal absorption band.^35–38 As the longitudinal plasmon absorption band is a strong function of the aspect ratio of the nanoparticle, the observed diversity in the optical properties of synthesized AuNPs, could be attributed to their different aspect ratios which led to the different SPR patterns.

The specific interactions of biomolecules with nanoparticle faces, through adsorption and desorption, can kinetically affect the growth rates of faces which finally control the shape and aspect ratios of nanoparticles.³⁹ As the lowest-energy state is related to the spheres, controlled reduction of metal salts by reducing agents has been reported generally in favour of producing spherical nanoparticles.⁴⁰ The synthesized nanoparticles were different in shape with average hydrodynamic diameter of 98.38 and 148.33 nm and with polydispersity index (PDI) of 0.276 and 0.33 for ethanolic and aqueous extracts, respectively.

Based on AFM and SEM analysis (Fig. 2), the aqueous extract synthesized nanoparticles exhibit relatively more uniform height than the ethanolic nanoparticles which display more pyramid like and symmetric shapes. TEM images showed that the nanoparticles are highly monodisperse with relatively uniform size of less than 20 nm. With respect to the shape, a combination of spherical, semi-spherical, hexagonal and triangular nanoparticles were observed in most of the colloids (Fig. 3). The crystal structure of the AuNPs was further evidenced by SAED pattern (inset in Fig. 3). The low contrasting regions around the high contrast particles in TEM images (Fig. 3) represent the organic compounds adsorbed on the nanoparticle surfaces which led to the stabilization of the AuNPs in colloids. Unlike TEM that provides information regarding to the diameter of individual nanoparticles, DLS also takes the organic shell into account determining the whole size of the conjugates in the colloids or their average hydrodynamic size. As the number of biomolecules covering each nanoparticle in colloids is high, the hydrodynamic size obtained by DLS measurement (Fig. 2) is considerably greater than the size obtained by TEM.

Fig. 2 Left to right: UV-vis spectra, hydrodynamic size, SEM image, and AFM topography of AuNPs synthesized by aqueous (above) and ethanolic (below) extracts of T. baccata.

Fig. 3 Low and high resolution TEM images and SAED pattern of AuNPs synthesized using the ethanolic (left) and aqueous (right) extracts of T. baccata. Arrows indicate the nanoparticles with triangular and other non-spherical shapes.

However, an obvious difference regarding to the stability of synthesized nanoparticles was observed between aqueous and ethanolic extracts. While the aqueous extract encapsulated AuNPs were mostly agglomerated and precipitated in a few days after synthesis, the application of ethanolic extract led to the stable colloids that in some cases, were completely stable even after more than 6 months.

The concentration of ethanolic extract had also direct effect on the nanoparticle stability while increasing the concentration of aqueous extract led to the synthesis of unstable nanoparticles which were followed by a rapid agglomeration and precipitation. The most stable colloids with zeta potential value of −15.7 were obtained by using the high concentration of ethanolic extract and 0.2 mM chloroauric acid. In a similar manner, increasing the concentration of metal ions to 0.3 mM, resulted in the considerable agglomeration and precipitation of AuNPs. Apart from the type of Taxus extract, all the reactions rapidly changed in color following the addition of chloroauric acid which indicates the high reduction potential of the extracts. The concentration of chloroauric acid can significantly influence the reaction rate, where the reaction proceeded significantly slower in low concentration (0.1 mM) of metal ion. In general, the interdependence between the role of metal ion concentration, as substrate, and plant extract concentration, as reducing and capping agent, mainly determines the rate of reaction. Surprisingly, time-dependent UV-vis spectra of the reaction, containing 1 mL of ethanolic extract and 0.2 mM chloroauric acid, revealed an interesting result: the absorption ratio of transverse resonance to longitudinal resonance decreased with reaction time. In the other word, a concomitant decrease in the relative intensity of transverse plasmon band respect to the longitudinal plasmon band was observed (Fig. 4). Similar findings were reported previously by Shankar et al.⁴ regarding to the synthesis of a high percentage of thin, flat, single-crystalline gold nanotriangles by a process involving rapid reduction, assembly and room-temperature sintering of ‘liquid-like’ spherical AuNPs.

Fig. 4 Time-dependent UV-vis spectra of the synthesized AuNPs in the presence of ethanolic extract of T. baccata after 2 min (a), 10 min (b), 30 min (c), 60 min (d) and 24 h (e). The figure inset shows corresponding color of colloidal nanoparticles.

The time-dependent change of optical properties was attributed by the authors to either formation of spherical gold nanoparticles that aggregate with time, formation of anisotropic particles whose aspect ratio increases with time, or a combination of both processes. Regarding to the considerable amount of spherical nanoparticles in the reactions, the time dependent aggregation of these nanoparticles could be suggested as probable reason of the optical changes in the present study. The results may also be attributed to the growth and conversion of spherical nanoparticles to the nanoparticles with different shapes. The photoinduced conversion of silver nanospheres to nanoprisms has also been reported, previously.⁴¹

The elemental analysis by energy dispersive spectroscopy (EDS), clearly indicates the presence of Au species in the precipitated nanoparticles (Fig. 5). While the high proportion of Au elements (up to 30%) could be clearly seen from element mapping of the compact sections of the sample (Fig. 5, spectrum 1 and 3), a considerably reduced Au elements signal (about 10%) was observed from the analysis of the outside section (spectrum 2). A large amount of C element existed in the spectra could be attributed to the support film used in the analysis. EDS mapping image (Fig. 5e) clearly showed the homogenous distribution of the gold elements in the samples indicating a highly monodisperse nature of the nanoparticles as confirmed by TEM images and polydispersity index (PDI) of the resulted nanoparticles.

Fig. 5 EDS spectra (a–c), corresponding to the three different regions labeled with “spectrum 1”, “spectrum 2” and “spectrum 3”, respectively, in the relevant SEM image (d), and EDS mapping image (e) of synthesized AuNPs by ethanolic extract of T. baccata.

FTIR analysis showed several peaks in the nanoparticles spectra as well as the plant spectrum indicating the bioorganic compounds of Taxus extracts bound to the nanoparticles surface during the synthesis process (Fig. 6). Comparison of the spectra from AuNPs and Taxus leaf powder revealed a high similarity between them which indicate the efficient adsorption of organic compounds on the nanoparticles. The FTIR spectra showed several sharp absorption peaks located at 2923 cm⁻¹, 2854 cm⁻¹, 1652 cm⁻¹, 1523 cm⁻¹, 1447 cm⁻¹, 1384 cm⁻¹, 1242 cm⁻¹, 1050 cm⁻¹ and 877 cm⁻¹, responsible respectively for C–H stretching of aldehyde groups, O–H stretching of carboxylic acids, C=N in plane vibrations of amino acids, amide II vibrations, COC stretching vibrations, OH stretching vibration, stretching vibrations of C–N aromatic and aliphatic amines, carbonyl stretch vibrations in ketones, and C–H stretching of aromatic compounds. In the ethanolic extract synthesized nanoparticles the bands 2923 cm⁻¹ and 2854 cm⁻¹ were shifted to lower frequency of 2918 cm⁻¹ and 2850 cm⁻¹, respectively, while the band 1050 cm⁻¹ was shifted to the higher frequency of 1057 cm⁻¹ when compared with the crude leaf powder.

Fig. 6 FTIR spectra of dried powder of T. baccata needles (curve 1) and AuNPs synthesized in the presence of aqueous extract (curve 2) and ethanolic extract (curve 3) of T. baccata.

In the ethanolic extract synthesized nanoparticles the bands 2923 cm⁻¹ and 2854 cm⁻¹ were shifted to lower frequency of 2918 cm⁻¹ and 2850 cm⁻¹, respectively, while the band 1050 cm⁻¹ was shifted to higher frequency of 1057 cm⁻¹ when compared with the crude leaf powder.

AuNPs can be simply conjugated with a variety of bio-functional molecules via physical methods.⁴² As taxane compounds contain various functional groups especially alcohols, aldehydes, and carboxylic acid (Fig. S2†), they could potentially adsorb on the nanoparticles and significantly impart in their encapsulation.

In vitro anticancer activity of AuNPs

To evaluate the potential anticancer activity of the biogenic AuNPs as well as their mechanism of action, a series of in vitro experiments were conducted including microscopic monitoring of cell morphology, MTT assay, flow cytometric analysis of cell death, and real-time expression analysis of some apoptosis related genes.

The optical microscopic monitoring of cancer cells following the exposure to AuNPs indicated the obvious change of cell morphology and suppression of cell proliferation, in comparison with the untreated cells (Fig. 7). With respect to data presented in Fig. 7, the cellular shrinkage, rounding and clumping can be clearly observed with some different levels in all the treated cell lines.

Fig. 7 Morphology changes of Caov-4 (left), HeLa (middle) and MCF-7 (right) cancer cells after treatment with gold nanoparticles for 48 h. The control and treated cells have been shown in the top and bottom, respectively.

A comprehensive MTT assay revealed widespread and potent anticancer activity of AuNPs on the three important and prevalent cancer cell lines, including MCF-7, Caov-4, and HeLa, depending on the nanoparticle concentration and exposure time (Fig. 8). Significantly different anticancer activities were obtained for the synthesized nanoparticles by aqueous and ethanolic extracts as well as for different cancer cell lines. The ethanolic extract synthesized AuNPs showed considerably higher anticancer activity on all the three cancer cell lines in comparison with the synthesized AuNPs by aqueous extracts. In the best condition, the maximum cell mortality of 80, 92, and 98% were obtained for Caov-4, MCF-7, and HeLa cancer cells, respectively, following the exposure to 20 μg mL⁻¹ ethanolic synthesized AuNPs for 72 h. In the same condition, more than 76, 77 and 84% cell mortality were obtained for aqueous extract synthesized AuNPs (Fig. 8). As the AuNPs are known as a non-toxic and biocompatible compound among metal nanostructures, their anticancer activity could be attributed to the adsorbed organic compounds of Taxus extracts on their surface. The observed anticancer activity was considerably higher than those from previously reported biogenic AuNPs.^14,28,43,44 Moreover, none of the previously reported AuNPs have shown such a widespread anticancer activity on different cancer cell lines based on our knowledge.

Fig. 8 Viability percentage of cancer (HeLa, Caov-4 and MCF-7) and non-cancerous (fibroblast) cells after 48 and 72 h incubation with different concentrations of AuNPs (2, 4, 8, 16 and 20 μg mL⁻¹), synthesized by aqueous (Aq) and ethanolic (Et) extracts of T. baccata.

The probable adverse effects of AuNPs on the non-cancerous cells of fibroblast were investigated using MTT assay at the same conditions (similar exposure periods and concentrations of AuNPs). Interestingly, the results indicated the significantly much less toxicity of AuNPs on the fibroblast cells as the maximum cell mortality of 22.15 and 26.5% were obtained after 72 h exposure to the aqueous and ethanolic extract synthesized AuNPs, respectively. This finding demonstrates the selective toxicity of synthesized AuNPs on cancer cell line. At the same conditions, the ethanolic and aqueous extracts of T. baccata displayed much less anticancer activities in comparison with the biogenic synthesized AuNPs (in none of the cases more than 50% mortality was observed (Fig. S3†)). However, regarding to the considerable anticancer activity of T. baccata extracts, it could be concluded that the organic compounds of Taxus extracts are responsible for the observed anticancer activity of AuNPs. In the other words, encapsulation of AuNPs with Taxus extracts led to the development of a biogenic nanocarrier with significant anticancer activity on various tumors. These simple, cost-effective and eco-friendly synthesized AuNPs seem to be useful toward the development of novel targeted cancer therapy using nanomedicine approach. It looks the comparable size of the AuNPs relative to the existing biomolecules in the extracts, enable them to effectively interact with and modify physiological processes of the cells and tissues.⁴² A probable alternative explanation for enhanced anticancer activity of nano-delivery systems than the pure extracts is the increased bioavailability and cell penetration of nanoparticles which facilitates the distribution and local concentration of the therapeutic agents which finally lead to the improved anticancer effects. The nano-formulation of the organic compounds may also improve their physicochemical stability and in vivo durability.

The capping agent seems to be a critical factor for determination of biological activity of nanoparticles by changing their surface properties such as charge, hydrophobicity and functionality. While AuNPs have been considered by some authors as nontoxic in spite of efficient endocytic uptake into human cells,^45–48 various results have been obtained regarding to the cytotoxicity of AuNPs based on their size, shape and surface chemistry.^49–52 For instance, Klekotko et al. have reported green synthesis of biocompatible AuNPs using Mentha piperita extract and claimed the main contribution of adsorbed organic compounds to reduce the cytotoxicity of AuNPs.⁴⁹ In the other related reports, exchanging cetyltrimethyl ammonium bromide (CTAB) with similar cationic surfactant on the surfaces of gold nanorods (GNRs),⁵⁰ over-coating of CTAB-capped GNRs with polyacrylic acid⁵¹ and coating of GNRs with polyethylene glycol instead of polystyrene sulfonate,⁵² have led to the enhanced stability and biocompatibility of GNRs. Accordingly, the promising anticancer activity of spherical AuNPs synthesized using the cell-free supernatant of Streptomyces clavuligerus, has been attributed to the anticancer compounds of microorganism adsorbed on the nanoparticles, in the valuable work, done by Ganesh Kumar et al.⁵³ However, our introduced method seems more suitable for the facile and large scale synthesis of AuNPs with various shapes and optical properties in comparison with the previously reported approaches. A green approach has also been reported recently for synthesis of anticancer AuNPs using apo-α-lactalbumin, as reducing and stabilizing agent.⁵⁴ Although using a simple component significantly reduces the reaction complexity and simplifies the interpretation of the results but the method seems inappropriate for cost-effective and large scale synthesis of nanoparticles. Moreover, the anticancer activity of the AuNPs synthesised by Taxus extracts is considerably more than apo-α-lactalbumin synthesized AuNPs.

According to the aforementioned discussion, it could be concluded that the rational selection of organic compounds as capping agents directly determines the biological characteristics of the synthesized nanoparticles. With regards to the vast diversity of plant compounds and their therapeutic effects, different biological activities, especially antimicrobial and anticancer effects, as well as biocompatible nanoparticles could be achieved. The use of Taxus extracts in the present study led to the development of high quality AuNPs that display high anticancer activity on a range of prevalent cancers.

Flow cytometric analysis of HeLa cells, after staining by annexin V-FITC and propidium iodide, was used to further investigate the cell death mode. To this aim, a series of experiments carried out using different concentrations of AuNPs as well as different exposure times. Annexin V protein is commonly used to detect phosphatidylserine molecules that specifically exist on apoptotic cell surfaces while the absorption and binding of propidium iodide to the nuclear DNA is commonly used to distinguish late-stage apoptosis and necrosis from early apoptosis.⁵⁵ The results indicated the dose- and time-dependent increase of cell death (Fig. 9).

Fig. 9 Dose- and time-dependent increase of apoptosis and necrosis in HeLa cancer cells after 24, 48 and 72 h treatment with different concentrations of AuNPs synthesized by ethanolic extract of T. baccata.

While most of the cells maintain their viability after 24 h exposure, the frequency of dead cells significantly increased in longer exposure periods, suggesting a delayed mode of cell death. More than 75% cell mortality was observed following AuNPs exposure for 72 h while the frequency of cell necrosis increased in higher concentrations of nanoparticles. However, dependence of cell death pathways (apoptosis versus necrosis) on the particle size³ and also necrosis as major cause of death in MCF-7 cells treated with chloroquine–gold nanoparticle conjugates,¹⁴ have been reported previously for other similar studies.

Studying the expression levels of apoptosis stimulated genes of caspase 8, caspase 9 and anti-apoptotic bcl-2 gene showed a concentration-dependent decrease of caspase 9 and bcl-2 without significant change of caspase 8 expression in AuNPs treated HeLa cells (Table 1). While a negligible decrease (15%) of caspase 9 expression was observed in the cells exposed to 2 μg mL⁻¹ AuNPs, the expression decreased to 0.45 in the presence of 8 μg mL⁻¹ AuNPs. A considerably more decrease was observed in the case of bcl-2 expression where more than 2 and 4 fold decreases occurred following the exposure of cancer cells to 2 and 8 μg mL⁻¹ AuNPs, respectively. The results firmly indicate the molecular mediated regulation of cancer cell death following the exposure to T. baccata synthesized AuNPs. According to the results, the biogenic AuNPs mainly induce cell death via down-regulation of anti-apoptotic bcl-2 gene. The activation of caspase 9 gene with no alteration in caspase 8 level has been reported recently in DU145 cancer cells treated with bacterial mediated AuNPs.⁵³

Table 1 Gene expression fold over control in HeLa cancer cells exposed to 2 and 8 μg mL⁻¹ AuNPs for 48 h

Gene	2 μg mL^−1	8 μg mL^−1
caspase 8	0.90 ± 0.06	1.04 ± 0.09
caspase 9	0.85 ± 0.65	0.45 ± 0.03
bcl-2	0.47 ± 0.05	0.24 ± 0.02

---

Based on the aforementioned results including slow cell death and non-significant change of caspase genes expression, a caspase-independent death program could be suggested as probable anticancer mechanism of gold nanoparticles. Slow cell death had been proposed to describe the delayed type of programmed cell death that occurs if caspases are inhibited or absent.⁵⁶ This claim is accordance with the previous report by Saeki et al. regarding to the induction of caspase-independent programmed cell death via bcl-2 down-regulation.⁵⁷

In this regards, in vitro toxicological study of CTAB stabilized GNRs functionalized by either thiolated polyethylene glycol or mercaptohexadecanoic acid (MHDA) has previously revealed the interesting results. Although, cell proliferation was not affected by both particles, a significant difference was observed in transcription levels of stress and toxicity related genes of GNR-MHDA exposed HaCaT cells.⁵⁸ The exposure to the AuNPs synthesized in the presence of sodium citrate has also been reported to induce no significant change in the transcriptional profile of HeLa cells.⁶ The results firmly indicate the critical role of surface functionalization of gold nanoparticles in induction of cytotoxicity and the change in transcription profile.

Experimental section

Materials

Dulbecco's modified Eagle's medium (DMEM), Roswell Park Memorial Institute medium (RPMI-1640), L-glutamine, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), dimethyl sulfoxide (DMSO), and tetrachloroauric acid(III) trihydrate (HAuCl₄·3H₂O) were obtained from Sigma (Germany). Organic solvents for taxane extraction and HPLC analysis were purchased from Merck (Darmstadt, Germany). Standard of Taxol was prepared by Calbiochem (San Diego, CA, U.S.A.) and standards of 10-deacetyl baccatin III and baccatin III were obtained from Sigma (Germany). Annexin V-FITC conjugate, cell staining buffer, and annexin V binding buffer were purchased from Biolegend (San Diego, CA). RPMI 1640 medium, fetal calf serum (FCS), and antibiotic solution (penicillin–streptomycin) were prepared from Gibco (Invitrogen, Grand Island, NY). TriPure reagent for RNA extraction was purchased from Roche (Germany). Reverta-L kit for reverse transcription was purchased from ILS (Moscow, Russia). RealQ Plus 2x Master Mix Green for real-time PCR was prepared from Ampliqon (Denmark). All of the aqueous solutions were prepared by double distilled water.

Preparation and analysis of T. baccata extracts

Freshly collected needles of T. baccata prepared from the flower garden of Isfahan, Iran. 2 grams of the dried powder of plant sample were suspended in 50 mL of distilled water or 80% ethanol and sonicated for 30 min. After shacking for 1 h, the extracts were filtered through Whatman no. 1 filter paper.

The presence of taxane compounds in the ethanolic extract was studied by HPLC analysis according to the previously reported methods^33,59 with some modifications. Briefly, the ethanolic extract was concentrated to dryness in a rotary evaporator at 75 °C and the residue was dissolved in 2 mL methanol and degreased for 4 h by using 1 mL distilled water. 20 μL portion of the filtered methanolic extract was analyzed by reverse phase HPLC (Sykam, Eresing, Germany) and UV detection at 227 nm following injection on to a reverse-phase column (Kromasil C18, 250 mm × 4.6 mm). The mobile phase consisted of isocratic (at constant concentration) methanol and water (70 : 30, v/v) with flow rate of 1 mL min⁻¹. The concentration of taxanes in the extract was determined at the same condition based on external standards of 10-deacetyl baccatin III, baccatin III, and Taxol.

Synthesis of AuNPs by T. baccata extracts

The details of synthetic reaction conditions are presented in Table 2. Accordingly, synthesis of AuNPs was carried out at 25 °C in the final volume of 20 mL. Appropriate volumes of the plant extract and double distilled water were mixed and the suitable amounts of HAuCl₄ solution (4 mM) were added dropwise to the extract solution under sonication.

Table 2 Reaction conditions for the synthesis of stable colloidal gold nanoparticles by using T. baccata extracts

	HAuCl4 (mM)	Extract type	Extract volume
1	0.1	Ethanolic, aqueous	1 mL
2	0.2	Ethanolic, aqueous	1 mL
3	0.3	Ethanolic, aqueous	1 mL
4	0.1	Ethanolic, aqueous	2 mL
5	0.2	Ethanolic, aqueous	2 mL
6	0.3	Ethanolic, aqueous	2 mL
7	0.1	Ethanolic, aqueous	3 mL
8	0.2	Ethanolic, aqueous	3 mL
9	0.3	Ethanolic, aqueous	3 mL
10	0.1	Ethanolic, aqueous	4 mL
11	0.2	Ethanolic, aqueous	4 mL
12	0.3	Ethanolic, aqueous	4 mL
13	0.1	Ethanolic, aqueous	5 mL
14	0.2	Ethanolic, aqueous	5 mL
15	0.3	Ethanolic, aqueous	5 mL

---

The reaction mixture was then incubated at 25 °C for 24 h without shaking and the synthesis progress was monitored periodically using UV-vis spectroscopy (Biochrom, Biowave II, UK) in the wavelength range between 300 and 800 nm. The corresponding dilutions of Taxus extracts were used as blank solution.

Characterization of the nanoparticles

The optical properties of AuNPs were studied using UV-vis spectroscopy after isolation of the final products by centrifugation and dispersion in water. The size and shape of the synthesized AuNPs were analyzed by using a high resolution transmission electron microscope (Philips CM200) at an accelerating voltage of 100–300 kV. The selected area electron diffraction (SAED) pattern was also recorded from TEM images and the crystal planes were analyzed by JCPDS software. Field emission scanning electron microscopy (FESEM, Hitachi S-4500II) was performed using an accelerating voltage of 15 kV.

The chemical composition of the nanoparticles was qualitatively determined by using an energy dispersive X-ray spectroscopy system (Hitachi S-3400) conjugated with FESEM. Surface topography of the biogenic nanoparticles was also analyzed by an atomic force microscopy (AFM, contact mode on a Dual ScopeTM scanning probe-optical microscope, DME equipped with a C-26 controller) following solution casting onto highly oriented glass slides. The hydrodynamic size distribution and zeta potential of colloidal nanoparticles were determined using ZEN 3600 Zetasizer (Malvern, Worcestershire, UK). The adsorption of the organic compounds of Taxus extracts on the surface of nanoparticles was studied by Fourier transform infrared spectroscopy (FTIR). To this aim, the freeze-dried samples of nanoparticles and dried powders of T. baccata needles were separately analyzed using FT/IR-6300 spectrometer (Jasco, Japan) with wavelength range of 4000 cm⁻¹ to 400 cm⁻¹.

Cytotoxicity assays

The anticancer activity of AuNPs on various human cancer cell lines, including MCF-7, Caov-4 and HeLa, as well as non-cancerous fibroblast cells was first determined by MTT assay. Briefly, the cells were seeded on 96-well plates at a density of 10⁴ cells per mL and cultured overnight at 37 °C with 5% CO₂, before 48 and 72 h incubation with different concentrations of AuNPs (2, 4, 8, 16 and 20 μg mL⁻¹). The medium was then discarded and 100 μL MTT (0.5 mg mL⁻¹ in media) was added into each well and incubated again at 37 °C for 4 h. The resulting formazan crystals were then dissolved in 150 μL DMSO and the absorbance was measured at 570 nm. The cell viability was determined as ratio of absorbance values from each treatment and the control. Cytomorphological changes of the cancer cells were also investigated by optical microscopy after exposure to AuNPs for 48 h.

Annexin V-FITC/propidium iodide staining was used to measure the frequency of apoptotic and necrotic cells. Briefly, 4 × 10⁵ HeLa cells were cultured in 6 cm dishes overnight before treatment with different concentrations of AuNPs (2, 4, and 8 μg mL⁻¹) for 24, 48, and 72 h. The medium was then separated and the cells were washed in PBS, harvested in the stored medium after trypsinization and finally collected by centrifugation. The staining was carried out according to the manufacturer's instruction (Biolegend, San Diego, CA). Briefly, the cell pellets were washed twice with cold staining buffer and re-suspended in 100 μL annexin V binding buffer. 5 μL annexin V-FITC (100 μg mL⁻¹) and 10 μL propidium iodide solution (0.5 μg mL⁻¹) were added and incubated for 15 min in dark condition. Following the addition of 400 μL binding buffer, the samples were used for flow cytometric analysis by BD FACS Calibur™ (BD Biosciences, San Jose, CA, USA) at an excitation wavelength of 488 nm. Data were collected for 2 × 10⁴ cells and analyzed using Win MDI 2.8 software.

The expression profiles of apoptotic related genes of bcl-2, caspase 8, and caspase 9 were studied by real-time PCR. The primer sequences and some related information have been presented in Table 3. Following incubation of HeLa cells (1 × 10⁶) with 2 and 8 μg mL⁻¹ AuNPs for 48 h, total RNA was extracted from treated and control cells by TriPure reagent according to the manufacturer's protocol. Two micrograms of total RNA were reverse transcribed using M-MLV reverse transcriptase with random hexamer primers according to the manufacturer's instruction. Real-time PCR was performed by a RealQ plus 2x Master Mix Green using a Rotor Gene 6000 (Corbett, Australia). Temperature programs include initial denaturation at 95 °C for 15 min following by 40 cycles of 15 s at 95 °C and 60 s at 57 °C. Relative expression levels were calculated using ΔΔC_t method with gapdh as internal reference gene.

Table 3 Primer sequences used for gene expression analysis

Gene	Sequence	Product size	Tm (°C)
bcl-2	F: ATGTGTGTGGAGAGCGTCAA	187 bp	59.6
	R: TCTTCAGAGACAGCCAGGAGA		59.9
caspase 8	F: GGGACAGGAATGGAACACAC	198 bp	58.5
	R: AGATGATGCCCTTGTCTCCA		58.4
caspase 9	F: CGAACTAACAGGCAAGCAGC	149 bp	59.8
	R: ACCTCACCAAATCCTCCAGAAC		59.9
gapdh	F: CTCCCGCTTCGCTCTCTG	208 bp	59.9
	R: TCCGTTGACTCCGACCTTC		59.0

---

Statistical analyses

All the experiments were performed in triplicate and data were expressed as the mean value ± standard deviation of three independent experiments. The results were analyzed using the Student's t test (Microsoft Excel, Microscoft Corporation, USA) and P values <0.05 were considered as statistically significant.

Conclusions

A simple, green and cost-effective method was presented for the efficient synthesis of colloidal gold nanoparticles using Taxus baccata extracts as reducing and stabilizing agents. The shape and optical properties of nanoparticles as well as their colloidal stability were simply controlled by the type and concentration of Taxus extract as well as the concentration of chloroauric ions. The type of plant extract was confirmed as most effective parameter in determination of the physico-chemical properties of nanoparticles. The organic compounds of T. baccata extracts not only showed good reduction activity but also significantly encapsulated the nanoparticles leading to the synthesis of high quality, stable and monodisperse AuNPs with the size of less than 20 nm. In fact, the presence of various organic compounds with different chemical nature in the extract provides a unique condition for one-step synthesis of AuNPs with various physicochemical characteristics which could not usually be obtained by using the single component. This eco-friendly approach also seems to be promising for large scale and cost-effective production of AuNPs especially for biomedical applications in comparison with the previously reported biogenic methods. However, further investigation for identification of the actual component(s) responsible for the reduction and stabilization of the colloidal AuNPs could be suggested in order to clarify the mechanism of nanoparticle synthesis as well as their biological properties.

An exhaustive cell viability assay clarified dose- and time-dependent anticancer activity of the biogenic AuNPs on the most prevalent tumors of breast, ovary and cervix. Moreover, the AuNPs showed a significantly higher anticancer activity on various cancer cell lines in comparison with the other reported studies in this area. As the nanoparticles showed significantly much less toxicity on the non-cancerous fibroblast cells, they could be used as potent and specific therapeutic agents for cancer therapy after targeting by the specific tumor ligands. Regarding to the biocompatibility of gold, the remarkable anticancer effect of the nanoparticles could be attributed to the adsorbed biological compounds. Moreover, the higher anticancer activity of the ethanolic synthesized AuNPs suggesting the significant role of adsorbed Taxus compounds in the biological activity of AuNPs. A combination of apoptosis and necrosis mediated cell death was observed in AuNPs treated cells depending on the concentration of AuNPs and exposure time. The transcription level of apoptosis related gene of bcl-2 also changed considerably in treated cells in a dose-dependent manner but AuNPs exposure had no significant effect on the expression of caspase 8 and caspase 9 genes. The overall results indicate the induction of caspase-independent apoptosis pathway of cell death following the exposure to AuNPs.

In general, the optical properties of AuNPs together with the anticancer effects of Taxus compounds were used to develop novel theranostic nanostructures with great potential for cancer therapy. A further process in order to the surface engineering and molecular targeting of the theranostic platforms toward specific tumors could be suggested before in vivo application for cancer therapy.

Acknowledgements

The financial supports of Iran National Science Foundation (Grant No. 94027036) and Research Council of University of Isfahan are gratefully acknowledged. Special thanks are also extended to Dr Asghar Habibnejad from Iran University of Science and Technology for his valuable help with electron microscopy analysis and Mr Mohammad Kardi for kindly help with real-time PCR analysis.

Notes and references

1. S. K. Das, C. Dickinson, F. Lafir, D. F. Brougham and E. Marsili, Green Chem., 2012, 14, 1322–1334.
2. F. Cheng, J. W. Betts, S. M. Kelly, J. Schaller and T. Heinze, Green Chem., 2013, 15, 989–998.
3. Y. Pan, S. Neuss, A. Leifert, M. Fischler, F. Wen, U. Simon, G. Schmid, W. Brandau and W. Jahnen-Dechent, Small, 2007, 3, 1941–1949.
4. S. S. Shankar, A. Rai, B. Ankamwar, A. Singh, A. Ahmad and M. Sastry, Nat. Mater., 2004, 3, 482–488.
5. R. Bhattacharya and P. Mukherjee, Adv. Drug Delivery Rev., 2008, 60, 1289–1306.
6. J. A. Khan, B. Pillai, T. K. Das, Y. Singh and S. Maiti, ChemBioChem, 2007, 8, 1237–1240.
7. I. Fratoddi, I. Venditti, C. Cametti and M. V. Russo, J. Mater. Chem. B, 2014, 2, 4204–4220.
8. J. R. Hwu, Y. S. Lin, T. Josephrajan, M. H. Hsu, F. Y. Cheng, C. S. Yeh, W. C. Su and D. B. Shieh, J. Am. Chem. Soc., 2009, 131, 66–68.
9. T. R. Kuo, V. A. Hovhannisyan, Y. C. Chao, S. L. Chao, S. J. Chiang, S. J. Lin, C. Y. Dong and C. C. Chen, J. Am. Chem. Soc., 2010, 132, 14163–14171.
10. J. Wang, G. Zhang, Q. Li, H. Jiang, C. Liu, C. Amatore and X. Wang, Sci. Rep., 2013, 3, 1157.
11. C. Chien, H. Chen, S. Lai, K. Wu, X. Cai, Y. Hwu, C. Petibois, Y. Chu and G. Margaritondo, J. Nanobiotechnol., 2012, 10, 10.
12. X. Huang, I. H. El-Sayed, W. Qian and M. A. El-Sayed, Nano Lett., 2007, 7, 1591–1597.
13. I. H. El-Sayed, X. Huang and M. A. El-Sayed, Nano Lett., 2005, 5, 829–834.
14. P. Joshi, S. Chakraborti, J. E. Ramirez-Vick, Z. A. Ansari, V. Shanker, P. Chakrabarti and S. P. Singh, Colloids Surf., B, 2012, 95, 195–200.
15. S. Vijayakumar and S. Ganesan, J. Nanomater., 2012, 2012, 734398.
16. P. V. Asharani, G. Low, K. Mun, M. P. Hande and S. Valiyaveettil, ACS Nano, 2009, 3, 279–290.
17. J. Virkutyte and R. S. Varma, Chem. Sci., 2011, 2, 837.
18. N. C. Sharma, S. V. Sahi, S. Nath, J. G. Parsons, J. L. Gardea-Torresdey and T. Pal, Environ. Sci. Technol., 2007, 41, 5137–5142.
19. M. V. D. Z. Park, A. M. Neigh, J. P. Vermeulen, L. J. J. de la Fonteyne, H. W. Verharen, J. J. Briedé, H. van Loveren and W. H. de Jong, Biomaterials, 2011, 32, 9810–9817.
20. A. Abbasi Kajani, A. K. Bordbar, S. H. Zarkesh Esfahani, A. R. Khosropour and A. Razmjou, RSC Adv., 2014, 4, 61394–61403.
21. S. Iravani, Green Chem., 2011, 13, 2638.
22. A. K. Mittal, Y. Chisti and U. C. Banerjee, Biotechnol. Adv., 2013, 31, 346–356.
23. A. K. Mittal, J. Bhaumik, S. Kumar and U. C. Banerjee, J. Colloid Interface Sci., 2014, 415, 39–47.
24. D. Baram-Pinto, S. Shukla, A. Gedanken and R. Sarid, Small, 2010, 6, 1044–1050.
25. P. K. Kar, S. Murmu, S. Saha, V. Tandon and K. Acharya, PLoS One, 2014, 9, e84693.
26. M. M. Rahaman Mollick, B. Bhowmick, D. Mondal, D. Maity, D. Rana, S. K. Dash, S. Chattopadhyay, S. Roy, J. Sarkar, K. Acharya, M. Chakraborty and D. Chattopadhyay, RSC Adv., 2014, 4, 37838–37848.
27. P. Piruthiviraj, A. Margret and P. P. Krishnamurthy, Appl. Nanosci., 2015, 1–7.
28. R. Geetha, T. Ashokkumar, S. Tamilselvan, K. Govindaraju, M. Sadiq and G. Singaravelu, Cancer Nanotechnol., 2013, 4, 91–98.
29. M. R. Kamala Priya and P. Iyer, Appl. Nanosci., 2015, 5, 443–448.
30. T. Zou, A. Ching, T. Lum, C. N. Lok, J. J. Zhang and C. M. Che, Chem. Soc. Rev., 2015, 44, 8786–8801.
31. M. Jeyaraj, M. Rajesh, R. Arun, D. Mubarak Ali, G. Sathishkumar, G. Sivanandhan, G. K. Dev, M. Manickavasagam, K. Premkumar, N. Thajuddin and A. Ganapathi, Colloids Surf., B, 2013, 102, 708–717.
32. H. Luo, Y. K. Nie, Y. J. Fu, Y. G. Zu, S. M. Li, W. Liu, L. Zhang, M. Luo, Y. Kong and Z. N. Li, J. Sep. Sci., 2009, 32, 192–201.
33. S. Li, Y. Fu, Y. Zu, R. Sun, Y. Wang, L. Zhang, H. Luo, C. Gu and T. Efferth, J. Pharm. Biomed. Anal., 2009, 49, 81–89.
34. J. Kasthuri, S. Veerapandian and N. Rajendiran, Colloids Surf., B, 2009, 68, 55–60.
35. K. L. Kelly, E. Coronado, L. L. Zhao and G. C. Schatz, J. Phys. Chem. B, 2003, 107, 668–677.
36. S. Shankar, A. Rai, A. Ahmad and M. Sastry, Chem. Mater., 2005, 17, 566–572.
37. P. K. Jain, K. S. Lee, I. H. El-Sayed and M. A. El-Sayed, J. Phys. Chem. B, 2006, 110, 7238–7248.
38. J. E. Millstone, S. J. Hurst, G. S. Métraux, J. I. Cutler and C. A. Mirkin, Small, 2009, 5, 646–664.
39. Y. Sun, B. Gates, B. Mayers and Y. Xia, Nano Lett., 2002, 2, 165–168.
40. C. J. Murphy, A. M. Gole, J. W. Stone, P. N. Sisco, A. M. Alkilany, E. C. Goldsmith and S. C. Baxter, Acc. Chem. Res., 2008, 41, 1721–1730.
41. R. Jin, Y. Cao, C. A. Mirkin, K. L. Kelly, G. C. Schatz and J. G. Zheng, Science, 2001, 294, 1901–1903.
42. E. C. Dreaden, A. M. Alkilany, X. Huang, C. J. Murphy and M. A. El-Sayed, Chem. Soc. Rev., 2012, 41, 2740–2779.
43. M. Tengdelius, D. Gurav, P. Konradsson, P. Påhlsson, M. Griffith and O. P. Oommen, Chem. Commun., 2015, 2, 8532–8535.
44. D. Mukundan, R. Mohankumar and R. Vasanthakumari, International Journal for Innovative Research in Science and Technology, 2005, 2347–3207.
45. E. E. Connor, J. Mwamuka, A. Gole, C. J. Murphy and M. D. Wyatt, Small, 2005, 1, 325–327.
46. R. Shukla, V. Bansal, M. Chaudhary, A. Basu, R. R. Bhonde and M. Sastry, Langmuir, 2005, 21, 10644–10654.
47. M. Murugan, K. J. P. Anthony, M. Jeyaraj, N. K. Rathinam and S. Gurunathan, J. Ind. Eng. Chem., 2014, 20, 1713–1719.
48. S. Patra, S. Mukherjee, A. K. Barui, A. Ganguly, B. Sreedhar and C. R. Patra, Mater. Sci. Eng., C, 2015, 53, 298–309.
49. M. Klekotko, K. Matczyszyn, J. Siednienko, J. Olesiak-Banska, K. Pawlik and M. Samoc, Phys. Chem. Chem. Phys., 2015, 17, 1–2.
50. A. M. Alkilany, P. K. Nagaria, M. D. Wyatt and C. J. Murphy, Langmuir, 2010, 26, 9328–9333.
51. A. M. Alkilany, P. K. Nagaria, C. R. Hexel, T. J. Shaw, C. J. Murphy and M. D. Wyatt, Small, 2009, 5, 701–708.
52. R. G. Rayavarapu, W. Petersen, L. Hartsuiker, P. Chin, H. Janssen, F. W. B. van Leeuwen, C. Otto, S. Manohar and T. G. van Leeuwen, Nanotechnology, 2010, 21, 145101.
53. C. Ganesh Kumar, Y. Poornachandra and C. Chandrasekhar, Nanoscale, 2015, 7, 18738–18750.
54. D. S. Yarramala, S. Doshi and C. P. Rao, RSC Adv., 2015, 5, 32761–32767.
55. R. Foldbjerg, P. Olesen, M. Hougaard, D. A. Dang, H. J. Hoffmann and H. Autrup, Toxicol. Lett., 2009, 190, 156–162.
56. L. E. Bröker, F. A. E. Kruyt and G. Giaccone, Clin. Cancer Res., 2005, 11, 3155–3162.
57. K. Saeki, A. Yuo, E. Okuma, Y. Yazaki, S. A. Susin, G. Kroemer and F. Takaku, Cell Death Differ., 2000, 7, 1263–1269.
58. C. Grabinski, N. Schaeublin, A. Wijaya, H. D'Couto, S. H. Baxamusa, K. Hamad-Schifferli and S. M. Hussain, ACS Nano, 2011, 5, 2870–2879.
59. A. Abbasi Kajani, S. Moghim and M. R. Mofid, Biotechnol. Appl. Biochem., 2012, 59, 223–227.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c6ra09050h

---