Highly sensitive visual detection of mutant DNA based on polymeric nanoparticles-participating amplification

Abstract

Taking advantage of the large surface area of nanoparticles and the structural repeating characteristics of the polymer, one type of polymeric nanoparticles-participating polymerization-based amplification system was created to enhance the sensitivity of detection. The polymeric nanoparticles with reducing poly(ascorbyl acrylate) as a hydrophilic shell could react with H₂O₂ to rapidly initiate redox polymerization of the monomer hydroxyl ethylacrylate. Such a redox polymerization system for molecular detection could render a visually discernible polymer film at the target DNA as low as 100 fM. Furthermore, a cascade of glucose oxidase (GOx) catalyzing the oxidation of glucose (consuming oxygen and generating H₂O₂in situ) and the nanoparticles-participating redox polymerization was set up to enable this assay to be performed in open air conditions. This assay was used to detect a non-small cell lung cancer p53 sequence and displayed excellent differentiation ability for a single-base mismatch as well. It is anticipated that such a design will provide a useful platform for the user-friendly, ultrasensitive and visual detection of a broad range of biomolecules.

---

Introduction

The detection of disease-related DNA, proteins and some special biomolecules in a stage as early as possible will significantly decrease the risk of malignant disease occurrence. However, due to low expression of these disease-related biomarkers in bodily fluids or tissues in the early stages of a disease, it is difficult to detect them with conventional detection methods. Therefore, the development of novel ultrasensitive detection strategies and biosensors has recently attracted considerable interest in the field of clinical diagnoses.^1,2 In past decades, great efforts have been made to realize ultrasensitive detection using signal amplification strategies. Successful signal amplification technologies include incorporating nanomaterials for increased loading of tags,^3–5 enzyme-participating amplification,^6,7 a DNA-related amplification technique,⁸ and a polymerization-based amplification strategy.^9–11 Amongst these, polymerization-based amplification (PBA) has recently emerged as a promising signal amplification technique for use in molecular diagnostics.

The PBA strategy is achieved through the use of dynamic polymer growth on the basis of the initiation of a radical polymerization coupled to molecular recognition at a surface. The resulting polymer materials contain hundreds to millions of repeating units that alter the optical properties at this location, leading to a visually distinguishable signal from the background.^12–21 Therefore, such an amplification method is promising to directly afford a qualitative readout for molecular diagnosis without the need of any equipment. At present, various polymerization reactions have been implemented in the PBA strategy, such as atom transfer radical polymerization (ATRP),^22,23 photo-polymerization^{13–21,24–27} and reversible addition–fragmentation chain transfer polymerization (RAFT).^12,28,29 These methods have shown their promise as a point-of-care technology. Despite significant developments, the PBA strategy is still a burgeoning research area, and exploring a creative polymerization method to further enhance the detection sensitivity and its operation by minimally trained users can be of high interest.

The sensitivity of PBA detection is directly correlated with the overall number of monomers involved in the polymerization. The density of the reaction initiators available on the targets is one important factor to accelerate polymerization and improve the detection sensitivity. Recently, the design of macroinitiators possessing molecular recognition was widely applied to realize an enhancement in sensitive detection as a useful method. For example, Bowman and his co-workers used macrophotoinitiators to detect biomolecules and reached a macroscopically observable response.¹⁰ He et al. made the use of polylysine as carriers to bring multiple polymerization reaction initiators for signal amplification, and the detection limitation was improved approximately 60 times.³⁰ Previously, our group reported chitosan with thousands of hydroxyl and amino groups as a macroinitiator to implement amplification-by-polymerization.³¹ Nanomaterials such as metallic nanoparticles,^32,33 quantum dots,^34,35 magnetic nanoparticles^36,37 and carbon based nanomaterials³⁸ are one very attractive family in the development of ultrasensitive assays because of their unique, size dependent physical and chemical properties. In addition to these inorganic nanomaterials, polymeric nanoparticles as another attractive nanomaterial have been widely applied in the field of drug delivery systems.^39,40 Due to their useful properties including an extremely large surface area and tunable chemical composition, polymeric nanoparticles provide the possibility to construct highly dense initiators for polymerization. To the best of our knowledge, few studies have been reported on taking advantage of these structural characteristics of polymeric nanoparticles applied in the PBA strategy to improve the sensitivity of detection.

Ascorbic acid (vitamin C) is a well-known, water-soluble nutrient that readily acts as a strong reducing agent. In addition to its physiological activity as an anti-oxidant,^41–43 ascorbic acid can combine with hydrogen peroxide to form water-soluble and biocompatible redox pairs (Scheme 1A) and is widely applied in emulsion polymerization and free radical-induced grafting reactions.^44–46 Because redox polymerization initiated by ascorbic acid/hydrogen peroxide (H₂O₂) can proceed under mild conditions by simply mixing redox pairs and monomer without any external energy supply, it is an easily operable and user-friendly polymerization system, and has the potential to be used in PBA platforms to improve the convenience of signal amplification. In addition, ascorbic acid as a water-soluble organic molecule is easy to chemically modify to generate the desired structure as well as maintain its reducing property.

Scheme 1 (A) The reported possible mechanism of redox polymerization initiated by ascorbic acid and hydroxyl peroxide. (B) Illustration of polymeric nanoparticles-participating PBA using hydrogen peroxide as an oxidant for model DNA detection.

To this end, we designed and constructed a reducing polymeric nanoparticles-participating PBA system for molecule detection. Based on the synthesis of two amphiphilic copolymers poly(ascorbyl acrylate)-block-polystyrene (PAA-b-PS) and biotin-functionalized polyethylene glycol-block-polystyrene (biotin-PEG-b-PS), the polymeric nanoparticles formed by the co-assembly of these two amphiphilic copolymers in aqueous solution consisted of a biotin-labeled-PEG and PAA hydrophilic outer shell and a PS hydrophobic core. A combination of the large surface area of the nanoparticles and structural repeating characteristics of PAA would generate an exponential increase in the reducing ascorbyl contents on the nanoparticle surface, which is beneficial to produce high initiation efficiency and enhance the sensitivity of the PBA system. In addition, it is well known that the biotin and streptavidin (SA) have a strong affinity, and one SA concurrently can bind with four biotin molecules. Therefore, in this study, SA as a bridge was used to link the biotin-labeled detection molecules and biotin-labeled polymeric nanoparticles. Based on this linkage, followed by the addition of H₂O₂ and monomer hydroxylethyl acrylate (HEA), a multitude of hydroxyl radicals generated by H₂O₂ combining with highly dense ascorbyl units on the shell of the polymeric nanoparticles rapidly initiated redox polymerization of HEA, resulting in a visible polymer spot on the substrates.

Notably, most free radical polymerizations, including redox polymerization, require the removal of oxygen via purging prior to the polymerization because molecular oxygen can inhibit the polymerization by reacting with propagating radicals to form inert peroxy radicals. This no doubt creates some inconvenience to conduct molecular detection using the PBA strategy. Glucose oxidase (GOx), as one popular enzyme, can catalyze glucose to generate gluconic acid and H₂O₂ through the consumption of oxygen.⁴⁷ To overcome oxygen inhibition of signal amplification, herein, GOx instead of H₂O₂ was further added into the polymeric nanoparticles-participating PBA system, and a cascade reaction of enzyme catalyzed oxidation and redox polymerization was set up. Through the use of GOx, on one hand, it is expected that all oxygen would be efficiently exhausted from the system and redox polymerization could be performed on open substrates under normal atmosphere, avoiding a complicated degassing procedure. On the other hand, H₂O₂ generated in situ from GOx-catalyzed oxidation of glucose could directly combine with ascorbyl units of polymeric nanoparticles to perform signal amplification. This enzyme-mediated polymeric nanoparticles-assisted cascade amplification system was demonstrated to be a more robust approach with greater specificity and enhanced assay sensitivity by the detection of a model analyte, human non-small cell lung cancer p53 sequence.

Experimental

Materials

Hydroxylethyl acrylate (HEA) was distilled three times under vacuum, and stored in a nitrogen atmosphere at 0 °C prior to use. Poly(ethyleneglycol)diacrylate (PEGDA, M_n = 575) was received from Sigma Aldrich. All DNA sequences were obtained from Sangon Biotech (Shanghai) Co., Ltd. and the gold substrates were purchased from Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences. The synthesis of homopolymer poly(benzyl ascorbyl acrylate) (PBnAA), block polymer poly(benzyl ascorbyl acrylate)-block-polystyrene (PBnAA-b-PS), PAA-b-PS and biotin-PEG-b-PS are described in the ESI.†

Characterization

The molecular weights and polydispersity index of the polymers were determined with Waters gel permeation chromatography (GPC) instrument equipped with a Styragel HR4E–HR5E chromatographic column, following a guard column and a differential refractive-index detector. The measurements were performed using THF as the eluent (flow rate of 1.0 mL min⁻¹ at 30 °C) and a series of narrowly distributed polystyrene standards for the calibration. The particle size of the nanoparticles was measured with dynamic laser scattering (DLS, Nano-ZS ZEN3600, Malvern) equipped with Zetasizer software at a laser light wavelength of 660 nm. The size measurements were carried out at 25 °C at a scattering angle of 90°. The nanoparticles were imaged on a Hitachi H800 transmission electron microscopy (TEM) (Hitachi High-Technologies Corporation, Tokyo, Japan) operated at 100 kV. A real-time FT-near IR (FT-NIR) spectrometer (Nicolet 5700) equipped with a MCT/A KBr detector-beam splitter combination was used to monitor the polymerization kinetics. A horizontal transmission accessory enabled horizontal sample mounting for FT-NIR measurements. The thickness of the polymer grafted on an Au substrate was measured with a Dektak XT profilometer (Bruker, Germany).

Preparation of the polymeric nanoparticles from biotin-PEG-b-PS and PAA-b-PS. Briefly, the mixture of biotin-PEG-b-PS and PAA-b-PS was prepared by varying the molar ratio from 1 to 10 and dissolving it in 1.0 mL of DMF. Then, ultrapure water (10 mL) was added at a rate of one drop (ca. 0.02 mL) per second under vigorous stirring. After 1.0 h, the solution was centrifuged and rinsed with a phosphate buffering solution (0.1 M, pH 6.0) to remove the organic phase. The morphology of the nanoparticles was measured by TEM and DLS.

The polymerization kinetics of HEA in the presence of polymeric nanoparticles, GOx and glucose. The polymerization of HEA using polymeric nanoparticles, GOx and glucose as a redox couple was monitored by a FT-NIR spectrometer working in the rapid mode with an average 3 scans per s collection rate (4 cm⁻¹). The dependence of the HEA monomer conversion on the GOx concentration was conducted by polymeric nanoparticles (1.0 mg mL⁻¹), glucose (250 mg mL⁻¹), HEA (2.0 M), PEGDA (2 vol%) and GOx with a predetermined concentration. And, the effect of glucose concentration on polymerization kinetics of HEA was carried out by glucose concentration varied between 25 and 500 mg mL^–1 and keeping GOx (1.0 mg mL^–1), polymeric nanoparticles (1.0 mg mL^–1), HEA (2.0 M) and PEGDA (2%). The polymerization kinetics was measured by the disappearance of the acrylate double bond at 6180 cm⁻¹, which is the CH₂ stretch first overtone peak. The percentage of conversion, directly related to the decrease in NIR absorbance, was calculated from eqn (1):where (A₆₁₈₀)₀ and (A₆₁₈₀)_t stand for the area of the NIR absorption peak at 6180 cm⁻¹ of the sample before polymerization and after polymerization at time t.

Detection of DNA. The Au substrates were cleaned in a solution (H₂SO₄/H₂O₂, v/v = 7/3) prior to use. A 3 μL aliquot of C-DNA, shown in Table 2, with a thiol group at the 5′-end was spotted onto clean Au substrates with 10 μM in 1× TE buffered saline at 4 °C, and incubated in a humid chamber for 15 h, followed by rinsing with 0.01 M Tris–HCl (pH 7.6) and ultrapure water. Then, these Au substrates were soaked in 1 wt% BSA solution for another 30 min to block excess active groups and nonspecific binding sites. The substrates were rinsed by PBS (0.01 M) and ultrapure water.

Table 1 Molecular characteristics of the synthesized polymers

Polymer	DPn^a	M n (NMR)^b	GPC^c
			M n	M w/Mn
a The repeating number of each segment calculated by ^1H NMR. b The number-average molecular weights of the polymers were calculated by ^1H NMR results. c Determined by GPC. d Homopolymer poly(benzyl ascorbyl acrylate). e Block polymer poly(benzyl ascorbyl acrylate)-block-polystyrene. f Not determined.
PBnAA^d	32	13 300	4430	1.13
PBnAA-b-PS^e	32/18	15 200	5660	1.20
PAA-b-PS	32/18	8900	n.d.^d	n.d.^f
Biotin-PEG-b-PS	88/44	9000	30 200	1.31

---

Table 2 Summary of model DNA sequences and partial p53 gene sequences used in this study

	Name	Sequence
Model DNA	C-DNA	5′-SH-(CH2)6-(A)10-GATGGGCCTCCGGTTCAT-3′
	T-DNA	5′-Biotin-ATGAACCGGAGG̲CCCATC-3′
	Nc-DNA	5′-Biotin-ATGAACCGGAGA̲CCCATC-3′
Partial p53 DNA	Wild type p53	5′ATGGGCGGCATGAACCGGAGG̲CCCATCCTC-3′
	Mutant p53	5′ATGGGCGGCATGAACCGGAGA̲CCCATCCTC-3′
	Capture DNA	5′CCGGTTCATGCCGCCCAT-(A)10-(CH2)6-SH-3′
	Signal DNA	5′-Biotin-GAGGATGGGTCT-3′

---

Hybridization. A 3 μL aliquot of the mixture solution containing 4× SSC, 20 vol% formamide deionized and T-DNA (4 μM) was spotted on the top of the immobilized C-DNA. After 80 min of hybridization at 37 °C, the Au substrates were rinsed with 0.01 M Tris–HCl and ultrapure water.
SA binding. A 3 μL aliquot of SA (5 μM) in PBS (0.01 M, pH 6.0) was spotted on the abovementioned substrates and incubated at 4 °C for 2 h. The substrates were further rinsed with 0.01 M PBS and ultrapure water. Subsequently, 3 μL polymeric nanoparticles (1.0 mg mL⁻¹, pH 6.0) were added onto the spot of SA and incubated at 4 °C for 2 h, followed by washing with ultrapure water and drying with nitrogen.
Redox polymerization-based amplification. A 3 μL aliquot of the degassed reaction solution including monomer HEA (2.0 M), PEGDA (2.0 vol%) and H₂O₂ (1.0 M) was spotted locally at the immobilized DNA to react at 37 °C for 40 min. The substrates were rinsed with deionized water and dried with nitrogen for measurement. The similar operations of hybridization, SA binding and redox polymerization were performed for sm-DNA on an Au substrate as a control.

For a cascade of GOx catalyzed oxidation of glucose and polymeric nanoparticles-participating redox polymerization to conduct signal amplification, almost all procedures were identical to the abovementioned conditions, except that 3 μL of the solution including monomer HEA (2.0 M), PEGDA (2.0 vol%), GOx (1.0 mg mL⁻¹) and glucose (250 mg mL⁻¹) was spotted at the DNA location.

Detection of mutant p53 gene. Recognition of mutant p53 DNA was performed by sandwich-type hybridizing with capture DNA and signal DNA, which were partially complementary to mutant p53.
Hybridization. On the basis of the immobilization of capture DNA on Au substrates, 3 μL of the mixture solution containing 4× SSC, 20 vol% formamide deionized, mutant or wild type p53 (1 μM) was spotted on the top of capture DNA. After 80 min hybridization at 42 °C, the Au substrates were rinsed with 0.01 M Tris–HCl and ultrapure water. Subsequently, 3 μL of the mixture containing 4× SSC, formamide deionized (20 vol%) and signal DNA (4 μM) was spotted on the above hybridization location. After 80 min hybridization at 25 °C, the spot was rinsed with 0.01 M Tris–HCl and ultrapure water.

The following SA binding and redox polymerization-based amplification were identical to those of model DNA detection.

Results and discussion

Synthesis and characterization of PAA-b-PS/biotin-PEG-b-PS polymeric nanoparticles

Two amphiphilic copolymers, PAA-b-PS and biotin-PEG-b-PS, were fabricated by RAFT polymerization (Schemes S1 and S2 in the ESI†), and characterized by ¹H NMR and GPC, as shown in Table 1 and Fig. S1–S7,† respectively. The polymeric nanoparticles were formed through co-assembly of PAA-b-PS and biotin-PEG-b-PS with a molar ratio of 10 to 1, with biotin-labeled PEG and PAA blocks expected to dominate the surface to form a shell around the PS hydrophobic core (Fig. 1). The reducing PAA block in the hydrophilic shell of the polymeric nanoparticles would associate with H₂O₂ to initiate the HEA monomer to polymerize for signal amplification, and the biotin-labeled PEG segment would realize the recognition between polymeric nanoparticles and detected biomolecules through SA.

Fig. 1 Schematic illustration of polymeric nanoparticles formed from two amphiphilic copolymers PAA-b-PS and biotin-PEG-b-PS.

The co-assembled PAA-b-PS/biotin-PEG-b-PS nanoparticles were observed by TEM to be approximately 160 nm in diameter with a spherical shape (Fig. 2A). Dynamic light scattering (DLS) measurements indicated a comparable size of 210 nm in diameter (Fig. 2A, inset) with a narrow polydispersity index (0.024). The size of these polymeric nanoparticles at the concentration of 1.0 mg mL⁻¹ in phosphate buffered solution (0.1 M PBS, pH 6.0) over time was also monitored by DLS. No evident changes in size were observed over 60 h and PDI slightly fluctuated between 0.024 and 0.087 (Fig. 2B), which indicated good stability of these polymeric nanoparticles.

Fig. 2 (A) TEM image of PAA-b-PS/biotin-PEG-b-PS polymeric nanoparticles, scale bar is 1.0 μm (inset: DLS diagram of PAA-b-PS/biotin-PEG-b-PS polymeric nanoparticles). (B) The change in size of PAA-b-PS/biotin-PEG-b-PS nanoparticles in PBS (0.1 M, pH 6.0) at 25 °C over time by DLS measurement.

Polymeric nanoparticles-participating PBA using hydrogen peroxide as oxidant for DNA detection

DNA detection was used to validate the polymeric nanoparticles-participating PBA strategy. Gold substrates were selected simply because of easy conjugation for thiolated DNA and the same detection strategy is applicable for other surfaces as well. A synthetic oligonucleotide system (model DNA in Table 2) was selected for detection in three consecutive yet independent stages: hybridization, linkage and amplification (Scheme 1B). Based on the immobilization of C-DNA (10 μM, 3 μL) on a fresh Au substrate through the binding interaction between thiol and Au, the biotin-labeled complementary probes (T-DNA) and single mutant DNA (sm-DNA, relative to T-DNA) sequences were respectively spotted on the location of C-DNA, leading to the formation of a DNA duplex at the desired location. After the successful hybridization of DNA, the successive addition of SA and PAA-b-PS/biotin-PEG-b-PS nanoparticles realized the connection between the detected molecules and polymeric nanoparticles via a strong SA–biotin affinity.

Subsequently, 3 μL of the degassed polymerization solution containing monomer HEA (2.0 M), crosslinker PEGDA (2.0 vol%) and oxidant H₂O₂ (1.0 M) was spotted locally at the immobilized DNA to react at 37 °C. According to the reported possible mechanism (Scheme 1A),^45,46 the redox polymerization of HEA was initiated by hydroxyl radicals generated from PAA-b-PS/biotin-PEG-b-PS nanoparticles and H₂O₂. In order to investigate the effect of the polymerization time on the signal amplification, the redox polymerization was stopped at the predetermined time, and the gold surface was washed by ultrapure water for the measurement of the formed polymer thickness by profilometry. Fig. 3A clearly exhibited the polymerization time-dependence signal amplification behavior. After a 10 min period of polymerization retardation, the polymer thickness increased with increasing polymerization time and reached a plateau after a 30 min reaction. Therefore, a 40 min polymerization time was selected in the following molecular detection. As the redox polymerization occurred, one distinguishable polymer film was directly observable by naked eyes at the specific spots where there existed the formation of a DNA duplex between T-DNA and C-DNA (marked with an a in the inset of Fig. 3B). In contrast, no film was visually discernible at the spot of sm-DNA (b in the inset). The measurement results of profilometry exhibited an average of a 360 nm thick polymer film formed at the perfect match spot; however, an average film thickness of 20 nm was measured at the sm-DNA spot (Fig. 3B). This suggested that this polymeric nanoparticles-participating PBA method had good feasibility in DNA sensing. The control experiments by non-SA-binding and the absence of PAA-b-PS/biotin-PEG-b-PS nanoparticles were performed on the substrates. No useful film growth was directly seen by naked eyes, and the thickness of the formed polymer films was below 10 nm, which was negligible (c and d in Fig. 3B). This indicates that hybridization, linkage and amplification were three necessary stages during DNA detection.

Fig. 3 (A) The polymer thickness formed by redox polymerization as a function of time at 37 °C. (B) Polymer growth under different conditions on Au substrate at 37 °C for 40 min. (a) C-DNA + T-DNA + SA + polymeric nanoparticles + polymerization systems; compared to (a), (b) sm-DNA instead of T-DNA; (c) without SA; (d) without polymeric nanoparticle. The photoimages of (a)–(d) at Au substrates are displayed in the inset. (C) The effect of various polymeric nanoparticles on polymer growth. (a) PAA-b-PS/biotin-PEG-b-PS nanoparticles; (b) PAA-b-PS/PEG-b-PS nanoparticles; (c) PAA-b-PS nanoparticles; (d) biotin-PEG-b-PS nanoparticles. (D) A logarithmic plot of polymer film thickness as a function of T-DNA concentrations. The error bars were calculated based on three replicates (inset: the photos of signal amplification at various T-DNA concentrations). Polymerization systems included 1.0 M H₂O₂, 2.0 M HEA and 2.0 vol% PEGDA. Data are shown as the mean ± S.D. of three independent experiments.

Compared to PAA-b-PS/biotin-PEG-b-PS nanoparticles possessing both the recognition molecule biotin and the highly dense reducing agent ascorbic acid, the spots at the formation of the DNA duplex at the desired location were incubated with PAA-b-PS nanoparticles with reducing initiation points, biotin-PEG-b-PS nanoparticles with a recognition molecule and PAA-b-PS/PEG-b-PS nanoparticles without biotin labeling, followed by adding polymerization conditions. As expected, no discernible polymer films were observed from either control nanoparticles after a 40 min reaction, and their average film thickness was below 10 nm measured by profilometry (Fig. 3C). This demonstrated that the successful construction of PAA-b-PS/biotin-PEG-b-PS nanoparticles was of great importance to realize the signal amplification.

The polymer film growth was investigated along with a T-DNA concentration that ranged from 10 fM to 1.0 μM, and the pronounced optical change of the array spots suggested distinguishable disparity with a change in T-DNA concentration. The thickness of these growing polymer films was measured by profilometry, and one typical curve of molecular detection is displayed in Fig. 3D. Approximately 17 nm positive film growth was measured from the spot incubated with 100 fM T-DNA well above the background signal of 1.2 nm. The limit of detection (LOD) was estimated to be below 0.3 attomol (3.0 μL T-DNA was used). Compared to the previously reported chitosan as a macromolecular reducing agent for redox polymerization-based signal amplification,³¹ wherein the obtained LOD was as low as 70 pM (3.0 μL was used, as well), it is conservatively estimated that over two orders of magnitude in detection sensitivity were improved using this polymeric nanoparticles-participating PBA method. It is important to note that close inspection of the array of spots incubated with different concentrations of T-DNA clearly exhibited the visual polymer films, even when the concentration of target DNA was as low as 100 fM (the inset of Fig. 3D).

A cascade of GOx catalyzed oxidation and polymeric nanoparticles-participating PBA for DNA detection

Oxygen is one of the big obstacles that can inhibit the redox polymerization via reacting with radicals generated by ascorbic acid and H₂O₂, leading to false negative results. In order to avoid such readout errors in the detection, the removal of oxygen from the polymerization systems is of great essential prior to the reaction. Although purging the polymerization system with inert gas is one popular method to remove oxygen, purging would possibly impact the reproducibility of the detection results to some degree and an extra purging operation would bring inconvenience to the users of the PBA method. Due to the properties of GOx catalyzed glucose oxidation, which can consume oxygen on-line and generate H₂O₂ (Scheme 2) in this study, GOx was further introduced into the polymeric nanoparticle-participating PBA system, and a cascade reaction of enzymatic catalyzing oxidation and redox polymerization was set up.

Scheme 2 Illustration of the cascade of GOx catalyzed glucose oxidation and polymeric nanoparticles-participating redox polymerization.

H₂O₂, as one product of GOx catalysis of glucose, is preferred to combine with PAA-b-PS/biotin-PEG-b-PS nanoparticles to form redox pairs for signal amplification, whereas, as the other product of this enzymatic reaction, the effect of gluconic acid on the redox polymerization-based signal amplification is necessarily demonstrated. As shown in Fig. 4A, with GOx (1.0 mg mL⁻¹ in 0.01 M PBS) catalyzing glucose (250 mg mL⁻¹), the environmental pH dramatically dropped from 6.0 to 2.8 during 60 min of monitoring. The initiation activity of redox pairs composed of PAA-b-PS/biotin-PEG-b-PS nanoparticles and H₂O₂ dependence of environmental pH was also investigated by FT-NIR spectra of the changes in the vinyl CH₂ absorbance as a function of polymerization time. The polymerization kinetic curve was obtained by the corresponding derivative of the conversion versus time, as depicted in Fig. 4B. As a result, the polymerization efficiency was gradually accelerated and HEA monomer conversion was notably enhanced with environmental pH decreasing. Moreover, the initiation activity of HEA conversion reached the highest level at pH 3.0, which indicates that the generation of gluconic acid would be a benefit to the enhancement of redox polymerization efficiency. The combination of the GOx enzymatic reaction and PAA-bearing nanoparticles can set up a cascade reaction for the PBA detection. The suitable concentration of GOx and glucose in this cascade was further optimized according to the procedures schematically shown in Fig. 4C and D. The polymerization efficiency of HEA was accelerated with the concentration of GOx and glucose increasing, and 250 mg mL⁻¹ glucose and 1.0 mg mL⁻¹ GOx were finally selected for the following PBA detection on the substrates.

Fig. 4 (A) pH change in the process of GOx (1.0 mg mL⁻¹ in 0.01 M PBS) catalyzing glucose (250 mg mL⁻¹); (B) time evolution of HEA conversion at various environmental pHs; (C) polymerization kinetics curves of HEA monomer dependence of GOx with 250 mg mL⁻¹ glucose; (D) polymerization kinetics curves of HEA monomer dependence of glucose concentration with 1.0 mg mL⁻¹ GOx. Other conditions included 1.0 mg mL⁻¹ polymeric nanoparticles, 2.0 M HEA, 2.0 vol% PEGDA and 200 μL total volume.

Based on the abovementioned optimal polymerization amplification conditions, the sensitivity and robustness of the cascade reaction of GOx catalyzed glucose oxidation and polymeric nanoparticles-participating redox polymerization were evaluated by detecting a model DNA sequence. As shown in Fig. 5A, such cascade reaction exhibited a distinguishable optical change with a change in T-DNA concentration. The relationship between the resulting polymer thickness and T-DNA concentrations, measured by profilometry, clearly displayed that this assay was extremely sensitive to the presence of T-DNA, and the estimated limit of detection (LOD) was similar to the abovementioned results. T-DNA as low as 50 fM could be detected with naked eyes at the polymerization system, including HEA (2.0 M), PEGDA (2 vol%), 250 mg mL⁻¹ glucose and 1.0 mg mL⁻¹ GOx. More importantly, due to the use of GOx, polymerization for signal amplification can be performed on open substrates under normal atmosphere, avoiding a professional degassing operation, which is helpful to develop an ultrasensitive and user-friendly diagnosis method for DNA detection.

Fig. 5 (A) The photographs of signal amplification caused by the cascade of GOx enzymatic reaction and polymeric nanoparticles-participating redox polymerization at various T-DNA concentrations. (B) A logarithmic plot of polymer film thickness caused by the cascade reaction as a function of T-DNA concentrations. The error bars were calculated based on three replicates.

Non-small cell lung cancer is a common lung disease caused by a point mutation at the fifth and seventh exons of the p53 gene.⁴⁸ Herein, partial mutant DNA sequences at the seventh exon of the p53 gene (the sequence information is listed in Table 2) were used to further confirm the fidelity of this cascade of GOx catalyzed reaction and polymeric nanoparticles-participating redox polymerization. A sandwich-type gene hybridization was applied to perform the molecular recognition, as depicted in Scheme 3. Briefly, capture DNA and biotin-functionalized signal DNA performed perfectly and complementary to mutant p53 as target DNA via a two-step hybridization, leading to the immobilization of mutant p53 on the substrates. A SA–biotin interaction was conducted to realize the linkage between signal DNA and polymeric nanoparticles. With the addition of the given GOx, glucose and HEA, polymerization amplification was performed at the desired spot in open well plates. The polymer growth was observed on the substrate incubated with the perfectly matched mutant sequences, as marked with (a) in Fig. 6A. As a control, wide-type p53 was noncomplementary to signal DNA, leading to no discernible patterns. Similarly, the other control experiments (c–f) in the absence of signal DNA, SA, polymeric nanoparticles or GOx exhibited no useful film growth, respectively.

Scheme 3 Schematic of the sandwich gene assay amplified by polymeric nanoparticles-participating PBA.

Fig. 6 (A) Polymer growth results under different conditions at Au substrate. (a) Capture DNA + mutant p53 + signal DNA + SA + polymeric nanoparticles + polymerization systems; comparing with (a), (b) wild p53 instead of mutant p53; (c) without signal DNA; (d) without SA; (e) without polymeric nanoparticles; (f) without GOx. The photoimages of (a)–(f) at Au substrates are displayed in the inset. (B) A logarithmic plot of polymer film thickness as a function of mutant p53 concentrations. The error bars were calculated based on three replicates. The corresponding photos were shown in the inset. (C) Dependence of polymer film thickness on varying the molar ratio of mutant p53 to wild-type p53 (inset: their corresponding photos). Polymerization systems included HEA (2.0 M), PEGDA (2 vol%), 250 mg mL⁻¹ glucose and 1.0 mg mL⁻¹ GOx. Data are shown as the mean ± S.D. of three independent experiments.

The amplification response at various mutant p53 concentrations was assessed by all these substrates treated with an identical mass of capture DNA (10 μM, 3 μL) and signal DNA (5 μM, 3 μL). As shown in Fig. 6B, the polymer signal above 5 pM of mutant p53 can be clearly discernible from the background in 40 min. Compared to the abovementioned model DNA, the detection sensitivity of mutant p53 was slightly decreased possibly due to the effect of one more hybridization step on the binding efficiency. However, this detection limitation is favorably comparable with that of the well-known Au nanoparticles (Au NP).⁴⁹

In addition, this cascade of enzymatic reaction and redox polymerization was further carried out to detect the mixture of mutant and wild p53 with molar ratios ranging from 1 : 0 to 1 : 500 (100 nM mutant p53 was kept constant). As shown in Fig. 6c, the observable spots were still discernible from the background as the molar content of wild p53 was increased. When mutant p53 was occupied as low as 1/200, the formed polymer film by the cascade reactions could be directly observed by naked eyes. This indicates that the interfering sequences did not affect the assay response when the mutant p53 content was above 0.5% of the mixed sequences under this condition. The strategy proposed in the present study is suitable for the identification of different p53 genotypes in risky populations simply by varying the signal DNA sequence according to the target sequence changing, while keeping all of the other parts of the assay fixed. Furthermore, this proposed amplification strategy would provide one promising way to develop a highly sensitive and user-friendly molecular diagnosis assay kit to give a visual clinical response of about 40 min for DNA detection.

Conclusion

In summary, based on a polymerization-based amplification concept, a new design for the ultrasensitive assay of mutant DNA is described, herein, that uniquely takes advantage of nanoparticle-assisted signal amplification. Redox polymerization composed of PAA-b-PS/biotin-PEG-b-PS nanoparticles and hydrogen peroxide as a signal amplification system significantly enhanced the accumulation of PHEA at the location where the detected molecules were attached, leading to the dramatic change in the surface reflectivity and opacity. An evident distinction at the spot of 100 fM (0.3 attomol) target DNA could be observed from the background by naked eyes within 40 min of polymerization. In addition, a combination of GOx catalyzing reaction and polymeric nanoparticles-participating redox polymerization enabled this assay to be more conveniently used in open air. The detection of a non-small cell lung cancer p53 sequence further exhibited a feasibility of this assay. This same strategy shows promise to be extended to the detection of protein such as in a sandwich immunoassay.

Acknowledgements

This study was supported by the Beijing National Laboratory for Molecular Sciences (BNLMS20150127), National Natural Science Foundation of China (NSFC, Grant No. 21174013; 21374005), the New Century of Ministry of Education (NCET-12-0754), and BUCT Fund for Disciplines Improvement Plan (2050205).

Notes and references

1. K. Yang and C. Y. Zhang, Anal. Chem., 2010, 82, 9500.
2. Y. H. Chen, M. R. Snyder, Y. Zhu, L. J. Tostrud, L. M. Benson, J. A. Katzmann and H. R. Bergen, Clin. Chem., 2011, 57, 1161.
3. K. C. Han, E. G. Yang and D. R. Ahn, Chem. Commun., 2012, 48, 5895.
4. H. Zhong, Q. L. Zhang and S. S. Zhang, Chem.–Eur. J., 2011, 17, 8388.
5. J. K. Seong and J. B. Allen, J. Am. Chem. Soc., 2012, 134, 10777.
6. F. L. Gao, J. P. Lei and H. X. Ju, RSC Adv., 2013, 3, 13163.
7. W. W. Zhao, Z. Y. Ma, P. P. Yu, X. Y. Dong, J. J. Xu and H. Y. Chen, Anal. Chem., 2012, 84, 917.
8. B. Zhang, B. Q. Liu, D. P. Tang, R. Niessner, G. N. Chen and D. Knopp, Anal. Chem., 2012, 84, 5392.
9. X. Lou, M. S. Lewis, C. B. Gorman and L. He, Anal. Chem., 2005, 77, 4698.
10. H. D. Sikes, R. R. Hansen, L. M. Johnson, R. Jenison, J. W. Birks, K. L. Rowlen and C. N. Bowman, Nat. Mater., 2008, 7, 52.
11. L. Yuan, X. Hua, Y. Wu, X. Pan and S. Liu, Anal. Chem., 2011, 83, 6800.
12. P. He, W. Zheng, E. Z. Tucker, C. B. Gorman and L. He, Anal. Chem., 2008, 80, 3633.
13. R. R. Hansen, H. D. Sikes and C. N. Bowman, Biomacromolecules, 2008, 9, 355.
14. H. D. Sikes, R. Jenison and C. N. Bowman, Lab Chip, 2009, 9, 653.
15. A. K. Badu-Tawiah, S. Lathwal, K. Kaastrup, M. Al-Sayah, D. C. Christodouleas, B. S. Smith, G. M. Whitesides and H. D. Sikes, Lab Chip, 2015, 15, 655.
16. K. Kaastrup and H. D. Sikes, RSC Adv., 2015, 5, 15652.
17. S. Lathwal and H. D. Sikes, Lab Chip, 2016, 16, 1374.
18. S. Lathwal and H. D. Sikes, Anal. Chem., 2016, 88, 3194.
19. K. Kaastrup, A. Aguirre-Soto, C. Wang, C. N. Bowman, J. W. Stansbury and H. D. Sikes, Polym. Chem., 2016, 7, 592.
20. A. J. Gormley, R. Chapman and M. M. Stevens, Nano Lett., 2014, 114, 6368.
21. D. Zhuang, H. Shen, G. Liu, C. Yu and J. Yang, J. Polym. Sci., Part A: Polym. Chem., 2014, 52, 2791.
22. H. Qian and L. He, Anal. Chem., 2009, 81, 4536.
23. H. Qian and L. He, Anal. Chem., 2009, 81, 9824.
24. R. R. Hansen, L. M. Johnson and C. N. Bowman, Anal. Biochem., 2009, 386, 285.
25. J. K. Lee and H. D. Sikes, Macromol. Rapid Commun., 2014, 35, 981.
26. K. Kaastrup and H. D. Sikes, Lab Chip, 2012, 12, 4055.
27. K. Kaastrup, L. Chan and H. D. Sikes, Anal. Chem., 2013, 85, 8055.
28. P. He and L. He, Biomacromolecules, 2009, 10, 1804.
29. P. He, E. Z. Tucker, C. B. Gorman and L. He, Anal. Methods, 2011, 3, 2463.
30. H. Qian and L. He, Sens. Actuators, B, 2010, 150, 594.
31. D. Zhuang, F. Wen, Y. Cui and J. Yang, J. Polym. Sci., Part A: Polym. Chem., 2016, 54, 1929.
32. W. Shen, H. Deng and Z. Gao, J. Am. Chem. Soc., 2012, 134, 14678.
33. W. Xu, X. Xie, D. Li, Z. Yang, T. Li and X. Liu, Small, 2012, 8, 1846.
34. C. Y. Zhang, H. C. Yeah, M. T. Kukori and T. H. Wang, Nat. Mater., 2005, 24, 826.
35. H. Ji, F. Yan, J. Lei and H. Ju, Anal. Chem., 2012, 84, 7166.
36. S. Bi, Z. Zhang, Y. Dong and Z. Wang, Biosens. Bioelectron., 2015, 65, 139.
37. Y. Zhang, Y. Guo, P. Quirke and D. Zhou, Nanoscale, 2013, 5, 5027.
38. M. Luo, X. Chen, G. H. Zhou, X. Liang, L. Chen, H. Ji and Z. He, Chem. Commun., 2012, 48, 1126.
39. K. Naresh, K. Ajay and K. J. Mukesh, J. Nanosci., NanoEng. Appl., 2015, 5(2), 32.
40. C. J. Bishop, K. L. Kozielski and J. J. Green, J. Controlled Release, 2015, 219, 488.
41. M. G. Traber and J. F. Stevens, Free Radical Biol. Med., 2011, 51, 1000.
42. S. B. Vuyyuri, J. Rinkinen, E. Worden, H. Shim, S. Lee and K. R. Davis, PLoS One, 2013, 8, e67081.
43. Q. Chen, M. G. Espey, A. Y. Sun, C. Pooput, K. L. Kirk and M. C. Krishna, Proc. Natl. Acad. Sci. U. S. A., 2008, 105, 11105.
44. R. J. Minari, M. Goikoetxea, I. Beristain, M. Paulis, M. J. Barandiaran and J. M. Asua, Polymer, 2009, 50, 5892.
45. U. G. Spizzirri, F. Iemma, F. Puoci, G. Cirillo, M. Curcio, O. I. Parisi and N. Picci, Biomacromolecules, 2009, 10(7), 1923.
46. N. Kohut-svelko, R. Pirri, J. M. Asua and J. R. Leiza, J. Polym. Sci., Part A: Polym. Chem., 2009, 47, 2917.
47. A. J. Gormley, R. Chapman and M. Stevens, Nano Lett., 2014, 14, 6368.
48. G. I. Evan and K. H. Vousden, Nature, 2001, 411, 342.
49. Y. Wan, P. Wang, Y. Su, L. Wang, D. Pan, A. Alddalbahi, S. Yang and X. Zuo, ACS. Appl. Mater. Interface, 2015, 7, 25618.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c6ra19860k

---